Table 5 Primers used for GUSB analysis
a) Primers used for primerwalking | |||||
|---|---|---|---|---|---|
Primer name | Sequence of forward primer (5'–3') | Strand orientation | Location in GUSB | Template DNA | TAnn(°C) |
GAPIntron10.f | ggggctgagtgttagacaatgca | plus | Intron 10 | PAC clone | 53 |
GAP5prime.f | cattaacggaagattgctttggt | plus | Intron 1 | PAC clone | 53 |
3-Strich.f | gcgagagaggtactggaaact | plus | Exon12 | PAC clone | 50 |
b) Primers used for long range PCR | |||||
Primer name | Sequence of primer (5'–3') | Sequence of reverse primer (5'–3') | Amplified part of gene | Length of product | T Ann (°C) |
AuEx8.f/AuEx9.r | caggctgcttactacttcaa | ggtcacgaaggtcacg | Intron 8 | 2660 | 55 |
AuEx9.f/AuEx10.r | cgtgaccttcgtgacc | accaggagtagtaactgttca | Intron 9 | 1717 | 55 |
AuEx10.f/AuEx11.r | atccagagcgagtacgg | gatactgctgtagcaggc | Intron 10 | 3221 | 55 |
AuEx11.f/AuEx12.r | tatgtggttggagagctca | caacaggaatgctgcact | Intron 11 | 1843 | 55 |
c) Primers used for SNP discovery and SNP typing | |||||
Primer names | Sequence of forward primer (5'–3') | Sequence of reverse primer (5'–3') | Amplified Exon (Length of Exon) | Length of Product (bp) | T Ann (°C) |
GUSBEx1.f/GUSBEx1.r | atcgccttcagtcaagatgg | ctctgggccagcagttcc | Ex 1 (213 bp) | 455 | 60 |
GUSBEx2.f/GUSBEx2.r | ggtgggtggcctggaatctgg | gcctcccccacccctcccta | Ex 2 (186 bp) | 465 | 60 |
GUSBEx3.f/GUSBEx3.r | ttgggagggttgcctcatctct | gagctcagattacatgcctccc | Ex 3 (188 bp) | 465 | 65.5 |
GUSBEx4.f/GUSBEx4.r | tgccgccagggaccattctc | ggtgccggcagagcccttct | Ex 4 (146 bp) | 458 | 59 |
GUSBEx5.f/GUSBEx5.r | tcctcagagtccaggtgctcc | acctgtccggcacccctgct | Ex 5 (191 bp) | 358 | 65 |
GUSBEx6.f/GUSBEx6.r | gtgaagctcacggcacagac | tgctctgagctgccctcagcc | Ex 6 (157 bp) | 241 | 65 |
GUSBEx7.f/GUSBEx7.r | agcacatcttggacagggaca | gagagggagggagtcacat | Ex 7 (187 bp) | 295 | 65 |
GUSBEx8.f/GUSBEx8.r | gatgtgactccctccctctc | tgaggtcccatggctggctga | Ex 8 (155 bp) | 235 | 63 |
GUSBEx9.F/GUSBEx9.r | ccccaccccatcccttcctg | gggtggaaacccggctgctt | Ex 9 (89 bp) | 510 | 59 |
GUSBEx10.f/GUSBEx10.r | ggtaggggtgccagcccaga | gcccaggcagggagtgaca | Ex 10 (185 bp) | 430 | 59 |
GUSBEx11.f/GUSBEx11.r | gctacgtcataccttggctgtg | ccgatccgattagcttgccct | Ex 11 (140 bp) | 431 | 65 |
GUSBEx12.f/GUSBEx12.r | cagcacgtctaaaccgtaagagga | actaccagattcagaccagaaact | Ex 12 (147 bp) | 409 | 60.9 |
d) Primers for tetra-primer ARMS-PCR | |||||
Primer combination | Sequence of forward primer (5'–3') | Sequence of reverse primer (5'–3') | Length of product (bp) | Detected allele | T Ann (°C) |
EX5outer.f/EX5outer.r | gcaaccgtagctcgggacacctgaga | aagaactttcacccatcctgcccctgg | 606 | none | 63.2 |
EX5innerG/EX5outer.r | ttctggatgaggaaggcagggggg | aagaactttcacccatcctgcccctgg | 342 | G | 63.2 |
EX5outer.f/EX5innerA | gcaaccgtagctcgggacacctgaga | ccccccgtccccttggcaat | 308 | A | 63.2 |