Skip to main content

Table 5 Primers used for GUSB analysis

From: Molecular characterization and exclusion of porcine GUSBas a candidate gene for congenital hernia inguinalis/scrotalis

a) Primers used for primerwalking
Primer name Sequence of forward primer (5'–3') Strand orientation Location in GUSB Template DNA TAnn(°C)
GAPIntron10.f ggggctgagtgttagacaatgca plus Intron 10 PAC clone 53
GAP5prime.f cattaacggaagattgctttggt plus Intron 1 PAC clone 53
3-Strich.f gcgagagaggtactggaaact plus Exon12 PAC clone 50
b) Primers used for long range PCR
Primer name Sequence of primer (5'–3') Sequence of reverse primer (5'–3') Amplified part of gene Length of product T Ann (°C)
AuEx8.f/AuEx9.r caggctgcttactacttcaa ggtcacgaaggtcacg Intron 8 2660 55
AuEx9.f/AuEx10.r cgtgaccttcgtgacc accaggagtagtaactgttca Intron 9 1717 55
AuEx10.f/AuEx11.r atccagagcgagtacgg gatactgctgtagcaggc Intron 10 3221 55
AuEx11.f/AuEx12.r tatgtggttggagagctca caacaggaatgctgcact Intron 11 1843 55
c) Primers used for SNP discovery and SNP typing
Primer names Sequence of forward primer (5'–3') Sequence of reverse primer (5'–3') Amplified Exon (Length of Exon) Length of Product (bp) T Ann (°C)
GUSBEx1.f/GUSBEx1.r atcgccttcagtcaagatgg ctctgggccagcagttcc Ex 1 (213 bp) 455 60
GUSBEx2.f/GUSBEx2.r ggtgggtggcctggaatctgg gcctcccccacccctcccta Ex 2 (186 bp) 465 60
GUSBEx3.f/GUSBEx3.r ttgggagggttgcctcatctct gagctcagattacatgcctccc Ex 3 (188 bp) 465 65.5
GUSBEx4.f/GUSBEx4.r tgccgccagggaccattctc ggtgccggcagagcccttct Ex 4 (146 bp) 458 59
GUSBEx5.f/GUSBEx5.r tcctcagagtccaggtgctcc acctgtccggcacccctgct Ex 5 (191 bp) 358 65
GUSBEx6.f/GUSBEx6.r gtgaagctcacggcacagac tgctctgagctgccctcagcc Ex 6 (157 bp) 241 65
GUSBEx7.f/GUSBEx7.r agcacatcttggacagggaca gagagggagggagtcacat Ex 7 (187 bp) 295 65
GUSBEx8.f/GUSBEx8.r gatgtgactccctccctctc tgaggtcccatggctggctga Ex 8 (155 bp) 235 63
GUSBEx9.F/GUSBEx9.r ccccaccccatcccttcctg gggtggaaacccggctgctt Ex 9 (89 bp) 510 59
GUSBEx10.f/GUSBEx10.r ggtaggggtgccagcccaga gcccaggcagggagtgaca Ex 10 (185 bp) 430 59
GUSBEx11.f/GUSBEx11.r gctacgtcataccttggctgtg ccgatccgattagcttgccct Ex 11 (140 bp) 431 65
GUSBEx12.f/GUSBEx12.r cagcacgtctaaaccgtaagagga actaccagattcagaccagaaact Ex 12 (147 bp) 409 60.9
d) Primers for tetra-primer ARMS-PCR
Primer combination Sequence of forward primer (5'–3') Sequence of reverse primer (5'–3') Length of product (bp) Detected allele T Ann (°C)
EX5outer.f/EX5outer.r gcaaccgtagctcgggacacctgaga aagaactttcacccatcctgcccctgg 606 none 63.2
EX5innerG/EX5outer.r ttctggatgaggaaggcagggggg aagaactttcacccatcctgcccctgg 342 G 63.2
EX5outer.f/EX5innerA gcaaccgtagctcgggacacctgaga ccccccgtccccttggcaat 308 A 63.2