Skip to main content

Table 4 Nucleotide sequences of the primers and probes used in qPCR (CPV) and rt-qPCR (CDV; CCoV) assays

From: Molecular and serological surveillance of canine enteric viruses in stray dogs from Vila do Maio, Cape Verde

Primers/Probe CPV (vp1gene AN AB437433.1) CDV (ngene AN JN896987.1) CCoV (7bgene (AN JQ404410.1)
Forward 5’ → 3’ GGGCCTGGGAACAGTCTTGACC (900 nM) TGGCACTCATTTTGGACATCAA (900 nM) TGGTCATCGCGCTGTCTACT (900 nM)
Reverse 5’ → 3’ ACCAGAGCGAAGATAAGCAGCG (900 nM) GCTAACCCAGCTTCCACAATGTA (900 nM) AGGGTTGCTTGTACCTCCTATTACA (900 nM)
TaqMan® probe 5’ → 3’ FAM CGCCGCTGCAAAAGAACACGACGAAGC TAMRA (250 nM) FAM TCCCCAGGGAACAAGCCTAGAATTGCT TAMRA (250 nM) FAM TTGTACAGAATGGTAAGCAC TAMRA (250 nM)
Product 99 bp 100 bp 66 bp