Skip to main content

Table 1 Primer sequences used for real-time RT-qPCR

From: Transcriptional approach to study porcine tracheal epithelial cells individually or dually infected with swine influenza virus and Streptococcus suis

Gene Genebank ID Amplicon size Forward sequence (primer #) Reverse sequence (primer #) Efficiency (qPCR)
Hipox NM_001032376 142 bp GCAGCCCCAGCGTCGTGATT CGAGCAAGCCGTTCAGTCCTGT 99
Ppia NM_214353 133 bp TGCAGACAAAGTTCCAAAGACAG GCCACCAGTGCCATTATGG 97
Ccl5 NM_001129946 78 bp GAAATGGGTGCGGGAGTACA GTTTGCACGAGTTCAGGCTC 94
Cox2 NM_214321 165 bp TAGGATTCAGGGCTTTCACTGGCT TGTCAGCCGACAATGAGATGTGGA 105
Ifnβ NM_001003923 150 bp TGCAACCACCACAATTCCAGAAGG TCTGCCCATCAAGTTCCACAAGGA 102
Il1a NM_214029 152 bp TGAAGATGGCCAAAGTCCCTGACCT ATCCATGCCGTCCCCAGGAAGTG 93
Il6 NM_214399 105 bp ACTCCCTCTCCACAAGCGCCTT TGGCATCTTCTTCCAGGCGTCCC 97
Il8 NM_213867 80 bp TGTGAGGCTGCAGTTCTGGCAAG GGGTGGAAAGGTGTGGAATGCGT 95
Il12a NM_213993 162 bp CTGAAGGCCGTCAGCAACAC AGCCAGGCAACTCTCATTCG 92
Ifnλ1 NM_001142837 135 bp TGGCCTTAGAGGCTGAGCTA CCCTGATGCAAGCCTGAAGT 91
Irf1 NM_001097413 113 bp AATCCAGCCCTGATACCTTCTCT GGCCTGTTCAATGTCCAAGTC 95
Irf7 NM_001097428 94 bp CTGCGATGGCTGGATGAA TAAAGATGCGCGAGTCGGA 90
Plau NM_213945 143 bp CTCCAAAGGCAGCCATGAAC CACAGTGCTCCCCTTGGAAT 106
Tnf NM_214022 112 bp GCCACCACGCTCTTCTGCCTA ACGATGATCTGAGTCCTTGGGCCA 91
Vcam1 NM_213891 126 bp TCCACGCTGGTCATGAATCC TGGGTCCTTGGGGAAAGAGTA 101