Skip to main content

Table 4 Characteristics of gene specific primers used for qPCR

From: Up-regulation of endoplasmic reticulum stress induced genes of the unfolded protein response in the liver of periparturient dairy cows

Gene1 Forward primer (from 5′ to 3′) Reverse primer (from 5′ to 3′) PCR product size (bp) NCBI GenBank
Reference genes    
ATP5B GGACTCAGCCCTTCAGCGCC GCCTGGTCTCCCTGCCTTGC 229 NM_175796.2
PPIA GGCAAATGCTGGCCCCAACACA AGTACCACGTGCTTGCCATCCA 87 NM_178320.2
RPL12 CACCAGCCGCCTCCACCATG CGACTTCCCCACCGGTGCAC 84 NM_205797.1
Target genes    
ATF4 TGGTCTCAGACAACAGCAAG AGCTCATCTGGCATGGTTTC 130 NM_001034342.2
ATM GTGTTGAGGCACTTTGTGATGC GTTTGATAATGGGCTGGTCTGC 111 NM_001205935.1
BAK1 TACTTCACCAAGATCGCGTC ACGATGGCTACGCTCTTGAT 254 NM_001077918.1
BAX TCTGACGGCAACTTCAACTG ATGGTCACTGTCTGCCATGT 224 NM_173894.1
BRCA1 TGCCGAGACAAGATCAAGAGG TAATTTCAGTGCAGAGGCTGAGG 149 NM_178573.1
CASP3 CCGAGGCACAGAACTGGACTG TCGCCAGGAAAAGTAACCAGGTG 133 NM_001077840.1
CASP8 TACCAGCGAGGAGGAGATGAAG CATCCAGCTTACATTTGGCAATC 164 NM_001045970.2
CASP9 AAACAGGATGACCCATCAAAGC ATTCAGGACATAGGCCAGATCG 203 NM_001205504.1
DDIT3 AGTCACTGCCTTTCTCCTTC TCTTCCTCCTTGTTTCCAGG 133 NM_001078163.1
DNAJC3 GTACGAAGGTGCTGAATGTG ATCAGGGTCACCATCTACTG 133 NM_174756.3
EDEM1 CCCCTACCCTCGGGTGAATCT GTGGAATCCCCCAGCAGTCG 126 NM_001103092.2
HERPUD1 CCGTGTTTCTCAGTATCCTC TCTTGATTCACAGCCTCCTG 169 NM_001102265.2
HSBP1 CGCGAACAAACGGAAGTATAGG CAGGTCATCAATGCGACTGC 207 NM_001113316.2
HSPA5 CAAGTTGATGTTGGAGGTGG AAGCCTCAGCAGTTTCCTTC 94 NM_001075148.1
HSPA8 AACGTGCTGATCTTTGATTTAGGG TTCTCCACCCAAGTGAGTATCTCC 114 NM_174345.4
MSH2 AACAGAAAGCCCTGGAGTTGG TTATTCTTTGCGATGACCTCAGC 226 NM_001034584.1
PDIA4 AGGTTTGACGTGAGTGGCTA CATCGAAGTTGTCCTTGGTC 175 NM_001045879.2
RPS9 GTGAGGTCTGGAGGGTCAAA GGGCATTACCTTCGAACAGA 108 NM_001101152.2
WARS AAGCAGACGAGGACTTTGTG TTCGGTTTACCAGCTCCTTG 123 NM_174218.1
XBP1 unspliced GTTGAGACAGCGGTTGGGAATG CGTAGTCTGAGTGCTGCGGAC 114 NM_001034727.3
XBP1 spliced & unspliced TGACTGAAGAGGAAGCAGAG CAATGCCATCAGAGTCCATG 129/155 NM_001271737.1
XRCC5 GTTTCAGTGTCTGCTTCACAGAGC TTCTTGATGACTTCCGTCAGAGG 165 NM_001102141.1
  1. 1ATP5B = ATP synthase; PPIA = peptidylprolyl isomerase A; RPL12 = ribosomal protein L12; other abbreviations of gene names are explained in footnotes of Tables 1 and 3.