Skip to main content

Table 1 Oligonucleotide primers used for PCR

From: A recombinant chimera comprising the R1 and R2 repeat regions of M. hyopneumoniae P97 and the N-terminal region of A. pleuropneumoniaeApxIII elicits immune responses

Primer Sequence (5' to 3') Accession # Gene Length (bp)
ApxN-F GGGGATCCGGCTACGATGTAACTAAAAATGGT L12145 apxIIIA 315
BamHI restriction sequence italicized
ApxN-R GGCTCGAGTTATTGTAAGAACTGATCCAGTTGCGG
XhoI restriction sequence italicized
P97C-F CGGGATCCAAACTGGATGACAACCTCCAA U50901 P97 954
BamHI restriction sequence italicized
P97C-R GGCTCGAGTTAAGGATCTCCGGATTTGCTGTCGTC
XhoI restriction sequence italicized
Ap97-F GGCCATATGCAAGTTAAAAAAGGCTACGATGTAAC L12145 apxIIIA 333
NdeI restriction sequence italicized
Ap97-R GGCGGATCCATGTTTTTGTTAGAACTGATCCAGTTG
BamHI restriction sequence italicized
AppCPS-F ACTATGGCAATCAGTCGATTCAT AY357726 capsular polysaccharide biosynthesis 500
AppCPS-R CCTAATCGG AAACGCCATTCTG
Mhyop102-F GTCAAAGTCAAAGTCAGCAAAC AF012905 P102 137
Mhyop102-R AGCTGTTCAAATGCTTGTCC