Skip to main content

Table 4 Primer sets for identification and mutation of P48 gene in M. bovis strain Hubei-1

From: Development of a direct competitive ELISA for the detection of Mycoplasma bovisinfection based on a monoclonal antibody of P48 protein

Primer Sequence (5′–3′) Aim
MB-F GCTTCATGTGGTGATAAATACTTTA Identify P48 gene
MB-R CTATTTTTGTGTTTCTTTAGCCAAT
MB-a CATGCCATGGGCGCTTCATGTGGTGATAAATACTTTA Mutate point 192
MB-a’ TGAAATTTTATGAACTGCTTCCCAACCAGATTGATTG
MB-b TCAATCAATCTGGTTGGGAAGCAGTTCATAAAATTTC Mutate point 648
MB-b’ CAGAAACTGCTGGCCAAGGAATACCACCGAAGG
MB-c CCTTCGGTGGTATTCCTTGGCCAGCAGTTTCTG Mutate point 1275
MB-c’ CAGCAGGTTGGTCTGGCCATTTTGTACCTAAAGC
MB-d CTTTAGGTACAAAATGGCCAGACCAACCTGCTGACC Mutate point 1317
MB-d’ CTATTTTTGTGTTTCTTTAGCCAACCAGTTAATCATTTTC
MB-e’ GCTTCTGGGTGTTCTTTATTCCAGTCAATAATACCTTGG Mutate point 699
MB-f CATTCCAAGGTATTATTGACTGGAATAAAGAACACCC