Skip to main content

Table 1 Details of PCR assays used in this study for nuc , tuf and mec A gene identification

From: Antimicrobial resistance and characterisation of staphylococci isolated from healthy Labrador retrievers in the United Kingdom

Primer Sequence (5′-3′) Amplicon size (bp) Annealing Temperature (°C) Control strain Reference
au-F3 TCGCTTGCTATGATTGTGG 359 57 S. aureus ATCC®25923 (LGC Standards, Teddington, UK) [77]
au-nucR* GCCAATGTTCTACCATAGC
pse-F2 TRGGCAGTAGGATTCGTTAA 926 57 S. pseudintermedius (clinical isolate)  
pse-R5* CTTTTGTGCTYCMTTTTGG
SSnucF AATGGCTACAATGATAATCACTAA 526 57 S. schleiferi subspecies coagulans ATCC®49545  
SSnucR* CATATCTGTCTTTCGGCGCG
tuf-F GCCAGTTGAGGACGTATTCT 412 55 S. epidermidis ATCC®12228 [105]
tuf-R CCATTTCAGTACCTTCTGGTAA
mecAF TGGCTATCGTGTCACAATCG 310 55 MRSA (clinical isolate) [103, 104]
mecAR CTGGAACTTGTTGAGCAGAG   
mA1 TGCTATCCACCCTCAAACAGG 286 57
mA2 AACGTTGTAACCACCCCAAGA     
  1. (*multiplex assay).