Skip to main content

Table 3 Primers used in this study

From: Detection and linkage to mobile genetic elements of tetracycline resistance gene tet(M) in Escherichia coliisolates from pigs

Primer use and primer Sequence (5′-3′) Reference
Detection tet (A)
Tet(A)-F GCTACATCCTGCTTGCCTTC [27]
Tet(A)-R CATAGATCGCCGTGAAGAGG [27]
Detection tet (B)
Tet(B)-F TTGGTTAGGGGCAAGTTTTG [27]
Tet(B)-R GTAATGGGCCAATAACACCG [27]
Detection tet (M)
Tet(M)-1 (266) GTTAAATAGTGTTCTTGGAG [16]
Tet(M)-2 (267) CTAAGATATGGCTCTAACAA [16]
Detection Tn 916 -like ( xis - Tn )
Tn916-1 (327) GCCATGACCTATCTTATA [20]
Tn916-2 (328) CTAGATTGCGTCCAA [20]
Detection Tn 5397 -like ( tndX )
Tn5397-tndX-1 (864) ATGATGGGTTGGACAAAGA [20]
Tn5397-tndX-2 (865) CTTTGCTCGATAGGCTCTA [20]
Detection Tn 5801 -like ( int )
intcw459-1 (1811) CCGATATTGAGCCTATTGATGTG [22]
intcw459-2 (1812) GTCCATACGTTCCTAAAGTCGTC [22]
Amplification and sequencing tet (M)
TetM-upstream (526) TTGAATGGAGGAAAATCAC [20]
TetM-up (323) CTGGCAAACAGGTTC [20]
TetM sequence-1 (525) TACTTTCCCTAAGAAAGAAAGT [20]
TetM sequence-3 (540) GCAGAAATCAGTAGAATTGC [20]
TetM sequence-6 (709) TCGAGGTCCGTCTGAAC [22]
Reverse TetM-2 (307) TTGTTAGAGCCATATCTTAG [20]
TetM sequence-9 (1756) AACAGTAAAATGTATAGAGGTG [22]
F2R (1837) GTGTCTTATACCATGGAAGGA [22]
TetM-down (324) TAGCTCATGTTGATGC [22]
Tet(M)-1 (266) GTTAAATAGTGTTCTTGGAG [16]