Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences of qPCR

From: Supplementation with conjugated linoeic acid decreases pig back fat deposition by inducing adipocyte apoptosis

Gene Primer sequences (5′ → 3′)
BCL2 F:TGATTTCTCCTGGCTGTCTC
R:GCCCGTCCACTTCACTTAT
Bax F:GAATGGGGGGAGAGACACCT
R:CCGCCACTCGGAAAAAGA
Cytochrome C F:GCCACCGCCTTATTTATTACAA
R:GAAACATTCCATCAGCCATACA
Caspase-3 F:TCTAACTGGCAAACCCAAACTT
R:AGTCCCACTGTCCGTCTCAAT
P53 F:TAGTTGCTGTTTCCGTGTGTTT
R:GGCTTCCGACCCAGTGTAT
TNFα F:CTCCCCTGTCCATCCCTTTAT
R:CAGCCCCTCATTCTCTTTCTAA
TNFR F:GCATTCTTCCTCTTCGTTGG
R:GCTTGGGATGGGACTGAAAG
β-actin F:GCGGCATCCACGAAACTAC
  R:TGATCTCCTTCTGCATCCTGTC