Skip to main content

Advertisement

Table 2 Primer sequences of qPCR

From: Supplementation with conjugated linoeic acid decreases pig back fat deposition by inducing adipocyte apoptosis

Gene Primer sequences (5′ → 3′)
BCL2 F:TGATTTCTCCTGGCTGTCTC
R:GCCCGTCCACTTCACTTAT
Bax F:GAATGGGGGGAGAGACACCT
R:CCGCCACTCGGAAAAAGA
Cytochrome C F:GCCACCGCCTTATTTATTACAA
R:GAAACATTCCATCAGCCATACA
Caspase-3 F:TCTAACTGGCAAACCCAAACTT
R:AGTCCCACTGTCCGTCTCAAT
P53 F:TAGTTGCTGTTTCCGTGTGTTT
R:GGCTTCCGACCCAGTGTAT
TNFα F:CTCCCCTGTCCATCCCTTTAT
R:CAGCCCCTCATTCTCTTTCTAA
TNFR F:GCATTCTTCCTCTTCGTTGG
R:GCTTGGGATGGGACTGAAAG
β-actin F:GCGGCATCCACGAAACTAC
  R:TGATCTCCTTCTGCATCCTGTC