Skip to main content

Table 1 Forward and reverse sequencing primers

From: Development of an in vitro model of acquired resistance to toceranib phosphate (Palladia®) in canine mast cell tumor

Primer Sequence range (bp) Start site 5′-Sequence-3′
FOR1 501–1000 448 GACGGACCCAGAAGTGACC
FOR2 1001–1500 948 CCTTGGAAGTAGTAGATAAAGGATTCA
FOR3 1501–2000 1453 AGTGGTTCAGAGTTCCATCG
FOR4 2001–2500 1948 CAAAGTCTTGAGTTACCTCGG
FOR5 2501–3000 2950 TGTGTGAAGCAGGAGGAGTG
REV1 500–1 552 CTGATCGTGATGCCAGCTT
REV2 1000–501 1040 CAATCAGATCCACATTCTGTCC
REV3 1500--1001 1542 GCAGAACTCCTGCCTACATTG
REV4 2000--1501 2040 TATTCTGTAATGACCAAGGTGGG
REV5 2500--2001 2552 TGAAAATGCTCTCAGGGGC