Diversity of Salmonella spp. serovars isolated from the intestines of water buffalo calves with gastroenteritis

  • Giorgia Borriello1Email author,

    Affiliated with

    • Maria G Lucibelli1,

      Affiliated with

      • Michele Pesciaroli2,

        Affiliated with

        • Maria R Carullo1,

          Affiliated with

          • Caterina Graziani2,

            Affiliated with

            • Serena Ammendola3,

              Affiliated with

              • Andrea Battistoni3,

                Affiliated with

                • Danilo Ercolini4,

                  Affiliated with

                  • Paolo Pasquali2 and

                    Affiliated with

                    • Giorgio Galiero1

                      Affiliated with

                      BMC Veterinary Research20128:201

                      DOI: 10.1186/1746-6148-8-201

                      Received: 8 May 2012

                      Accepted: 10 October 2012

                      Published: 25 October 2012

                      Abstract

                      Background

                      Salmonellosis in water buffalo (Bubalus bubalis) calves is a widespread disease characterized by severe gastrointestinal lesions, profuse diarrhea and severe dehydration, occasionally exhibiting a systemic course. Several Salmonella serovars seem to be able to infect water buffalo, but Salmonella isolates collected from this animal species have been poorly characterized. In the present study, the prevalence of Salmonella spp. in water buffalo calves affected by lethal gastroenteritis was assessed, and a polyphasic characterization of isolated strains of S. Typhimurium was performed.

                      Results

                      The microbiological analysis of the intestinal contents obtained from 248 water buffalo calves affected by lethal gastroenteritis exhibited a significant prevalence of Salmonella spp. (25%), characterized by different serovars, most frequently Typhimurium (21%), Muenster (11%), and Give (11%). The 13 S. Typhimurium isolates were all associated with enterocolitis characterized by severe damage of the intestine, and only sporadically isolated with another possible causative agent responsible for gastroenteritis, such as Cryptosporidium spp., Rotavirus or Clostridium perfringens. Other Salmonella isolates were mostly isolated from minor intestinal lesions, and often (78% of cases) isolated with other microorganisms, mainly toxinogenic Escherichia coli (35%), Cryptosporidium spp. (20%) and Rotavirus (10%). The S. Typhimurium strains were characterized by phage typing and further genotyped by polymerase chain reaction (PCR) detection of 24 virulence genes. The isolates exhibited nine different phage types and 10 different genetic profiles. Three monophasic S. Typhimurium (B:4,12:i:-) isolates were also found and characterized, displaying three different phage types and three different virulotypes. The molecular characterization was extended to the 7 S. Muenster and 7 S. Give isolates collected, indicating the existence of different virulotypes also within these serovars. Three representative strains of S. Typhimurium were tested in vivo in a mouse model of mixed infection. The most pathogenic strain was characterized by a high number of virulence factors and the presence of the locus agfA, coding for a thin aggregative fimbria.

                      Conclusions

                      These results provide evidence that Salmonella is frequently associated with gastroenteritis in water buffalo calves, particularly S. Typhimurium. Moreover, the variety in the number and distribution of different virulence markers among the collected S. Typhimurium strains suggests that within this serovar there are different pathotypes potentially responsible for different clinical syndromes.

                      Keywords

                      Salmonella Virulence markers Genetic characterization Gastrointestinal ecology

                      Background

                      Salmonella spp. found in water buffalo (Bubalus bubalis) herds are a matter of concern since they are responsible for serious economic losses in livestock and are a zoonotic agent responsible for foodborne illness [1]. As for bovine calves, Salmonella-induced diseases in water buffalo calves are characterized by severe gastrointestinal lesions, profuse diarrhea, and severe dehydration [1]. Acute salmonellosis generally induces diarrhea, mucous at first, later becoming bloody and fibrinous, often containing epithelial casts. Ingestion is the main route of infection, although it can also occur through the mucosa of the upper respiratory tract and conjunctiva. The major source of infection in the herd is represented by asymptomatic older animals shedding heavy loads of bacteria through feces. Other sources of infection are contaminated forages and water, as well as rodents, wild winged animals, insects and man [1, 2]. The disease can also cause sudden death without symptoms. Occasionally, the infection is systemic, affecting joints, lungs and/or the central nervous system (CNS) [1]. Moreover, several Salmonella serovars seem to be able to infect water buffalo, mainly affecting 1–12 week old calves, even though reports on salmonellosis in B. bubalis are scarce [1, 3].

                      Water buffalo calves are more frequently affected by gastroenteritis than bovine calves, with mortality rates as high as 70% in water buffalo species vs. 50% in bovine [1, 4]. This difference might be due to a greater susceptibility of water buffalo to gastroenteric pathogens, although it also may reflect the lack of appropriate management practices for this animal species. Therefore, water buffalo represents a suitable model to study causative agents of gastroenteritis. In water buffalo, S. enterica serovar Typhimurium can induce a variety of clinical syndromes with different anatomopathological lesions [1, 3]. The severity of the disease can depend on several factors, including host-pathogen interactions, which is highly influenced by the route of infection, the infectious dose, natural or acquired host resistance factors, and the possible presence of other pathogens. Moreover, specific Salmonella virulence factors, frequently located on Salmonella pathogenicity islands (SPIs), prophage regions or virulence plasmids, play a key role in the pathogenesis of the gastroenteritis [5].

                      The current study investigated the intestinal contents collected from 248 water buffalo calves affected by gastroenteritis with lethal outcome to: (i) evaluate the prevalence of Salmonella spp., and (ii) perform a polyphasic characterization of the collected isolates of S. Typhimurium.

                      Results and discussion

                      Salmonella spp. were isolated from 25% of the intestinal contents collected from 248 water buffalo calves affected by gastroenteritis with lethal outcome. Positive samples were detected in subjects bred in 37 of 58 farms (inter-herd prevalence, 64%). The S. enterica serovars most frequently isolated were Typhimurium (n=13), Muenster (n=7) and Give (n=7). Other recovered serovars were: Derby (n=5), 4 Bovismorbificans (n=4), Newport (n=4), monophasic S. Typhimurium (B:4,12:i:-; n=3), Blockley (n=2), Meleagridis (n=2), Umbilo (n=2), Altona (n=1), Anatum (n=1), Bredeney (n=1), Enterica (−;i;1,2; n=1), Gaminara (n=1), Haardt (n=1), Hadar (n=1), Infantis (n=1), Isangi (n=1), Kottbus (n=1), London (n=1), Muenchen (n=1), and S.II:41;z;1,5 (n=1). Phage-typing of the S. Typhimurium and monophasic Typhimurium strains (Table 1) indicated a variable distribution of phage types among strains with nine different phage types of 13 Typhimurium strains, and three different phage types out of three monophasic Typhimurium strains.
                      Table 1

                      Virulotypes and phage types of the Salmonella Typhimurium and monophasic S . Typhimurium isolates

                      Isolate #

                          

                      Genesa

                            

                      Genotype #

                      Phage type

                       

                      gipA

                      gtgB

                      gogB

                      sspH1

                      sodC1

                      gtgE

                      spvC

                      safC

                      csgA

                      pefA

                      agfA

                        

                      S. Typhimurium

                                   

                      16

                      -

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      -

                      1

                      DT1

                      92

                      -

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      2

                      DT104

                      112

                      -

                      -

                      -

                      +

                      -

                      -

                      -

                      -

                      +

                      -

                      -

                      3

                      RDNC

                      148

                      +

                      +

                      +

                      +

                      +

                      +

                      -

                      +

                      +

                      -

                      -

                      4

                      DT194

                      233

                      -

                      +

                      +

                      -

                      +

                      +

                      +

                      +

                      +

                      +

                      -

                      5

                      DT104

                      279

                      -

                      +

                      +

                      -

                      +

                      +

                      +

                      +

                      +

                      +

                      -

                      5

                      U302

                      107025

                      -

                      +

                      +

                      -

                      +

                      +

                      +

                      +

                      +

                      -

                      +

                      6

                      RDNC

                      461

                      +

                      +

                      +

                      -

                      +

                      +

                      -

                      +

                      -

                      -

                      -

                      7

                      DT208

                      10606

                      -

                      +

                      +

                      +

                      -

                      -

                      +

                      +

                      +

                      +

                      +

                      10

                      U302

                      51789

                      +

                      +

                      +

                      +

                      -

                      +

                      -

                      +

                      +

                      -

                      +

                      8

                      DT110

                      55137

                      +

                      +

                      +

                      +

                      -

                      +

                      -

                      +

                      +

                      -

                      +

                      8

                      DT20

                      82280

                      +

                      +

                      +

                      +

                      -

                      +

                      +

                      +

                      +

                      -

                      +

                      9

                      DT110

                      83528

                      +

                      +

                      +

                      +

                      -

                      +

                      -

                      +

                      +

                      -

                      +

                      8

                      NTb

                      Freq. (%)

                      46

                      92

                      92

                      69

                      54

                      85

                      54

                      92

                      92

                      38

                      54

                        

                      monophasic S. Typhimurium

                                   

                      154

                      -

                      +

                      +

                      +

                      +

                      +

                      -

                      -

                      -

                      -

                      +

                      11

                      DT193

                      175

                      -

                      -

                      -

                      +

                      -

                      -

                      -

                      +

                      -

                      -

                      -

                      12

                      U311

                      188

                      -

                      -

                      -

                      +

                      -

                      -

                      -

                      -

                      +

                      -

                      +

                      13

                      NT

                      a The following loci: invA, sspH2, stfE, ipfD, bcfC, stbD, fimA, avrA, ssaQ, mgtC, siiD, sopB were present in all the strains; the sopE gene was not found in any of these strains.

                      b NT = not typeable.

                      This study reports a significant prevalence of Salmonella spp. (25%) in diarrheic water buffalo calves, that are more relevant than those reported in previous studies (11 and 0.8%) [3, 6]. Moreover, in contrast with bovine species where salmonellosis results primarily associated with serovars Dublin and Typhimurium [5], the extremely variable distribution of the observed serovars confirms the absence of a serovar specifically adapted to water buffalo, as previously suggested [1]. These data provide therefore evidence that Salmonella, particularly S. Typhimurium, can be potentially considered an important pathogen for this animal species. The definitive phage type 104 (DT104), which has often been associated with multiple-antibiotic-resistant strains with ascertained zoonotic potential and, in many countries, has increased over the past two decades [5], does not seem to be widely spread in water buffalo. Three monophasic S. Typhimurium (B:4,12:i:-) isolates were also found that are S. Typhimurium lacking phase two flagellar antigens that have a rapid emergence and dissemination in food animals, companion animals, and humans. More significantly, the public health risk posed by these emerging monophasic S. Typhimurium strains is considered comparable to that of other epidemic S. Typhimurium [7].

                      The diagnostic investigation indicated that non-Typhimurium Salmonella isolates were detected with at least another potential pathogen in 78% of cases (Figure 1A). In 35% of cases Salmonella was linked with pathogenic Escherichia coli that were characterized for the presence of virulence factors. Other frequent associations were found with Cryptosporidium spp. (20%) and Rotavirus (10%) (Figure 1A). Remarkably, S. Typhimurium was never associated with pathogenic E. coli, while it was isolated sporadically with Clostridium perfringens (strain #82280), Rotavirus (strain #107025), and Cryptosporidium spp. (strain #112) (Figure 1B). The presence of more pathogens in the same subject might suggest that, as for other animal species [5], diarrhea in water buffalo calves can be characterized by a multifactorial etiology. Data from necroscopic examinations of tissues indicated that the lesions caused by S. Typhimurium were characterized by severe damage of the intestine, ranging from congestive to necrotic-ulcerative enterocolitis. In particular, the strains isolated from animals exhibiting the most severe lesions were #16, #92, #233, and #83528. Among these strains, the two DT104 strains were also found, thus supporting the pathogenic role of this phage type. The other Salmonella serovars were instead isolated from subjects exhibiting a variety of different lesions, mostly minor lesions confined to the jejunum, and often (78% of cases) associated with other pathogens. Similarly, the monophasic S. Typhimurium strains were detected either with Rotavirus (strain #154) or st-positive E. coli (strains #175 and #188). These data confirm the pathogenic potential of the serovar Typhimurium for water buffalo calves. On the other hand, the scarcity of observed lesions and the frequent presence of more than one microorganism in the same subject hamper a clear understanding of the potential pathogenic role of the non-Typhimurium Salmonella serovars included in this study.
                      http://static-content.springer.com/image/art%3A10.1186%2F1746-6148-8-201/MediaObjects/12917_2012_490_Fig1_HTML.jpg
                      Figure 1

                      Frequency of detection of Salmonella with other microorganisms. (A) Frequency of association of non-Typhimurium Salmonella isolates with microorganisms possibly responsible for gastroenteritis in water buffalo calves. (B) Frequency of association of S. Typhimurium strains with microorganisms possibly responsible for gastroenteritis in water buffalo calves.

                      S. Typhimurium and monophasic S. Typhimurium strains were further characterized by the molecular detection of 24 genes coding for virulence factors. The genetic characterization (Table 2) included five loci (avrA, ssaQ, mgtC, siiD, and sopB) located on SPI 1–5, respectively [8], eight loci (gipA, gtgB, sopE, sodC1, gtgE, gogB, sspH1, and sspH2) of prophage origin [913], the gene spvC, located on a virulence plasmid [12], and nine genes (stfE, safC, csgA, ipfD, bcfC, stbD, pefA, fimA, and agfA) coding for bacterial fimbriae, involved in surface adhesion and gut colonization [5]. As a positive control for the PCR assay, amplification of the chromosomal gene invA was carried out for each strain. All the S. Typhimurium and monophasic Typhimurium isolates displayed the presence of avrA, ssaQ, mgtC, siiD, sopB, sspH2, stfE, ipfD, bcfC, stbD, and fimA genes, and the absence of the sopE gene. Other loci were variably distributed among the strains, with frequency values ranging from 38-92% (Table 1). On the basis of the presence or absence of the 24 loci included in the study, the 13 strains of S. Typhimurium were subdivided into 10 different genotypes (Table 1); however, the isolates with identical genotype displayed different phage types suggesting the presence of 13 different strains. Interestingly, the three monophasic S. Typhimurium strains exhibited three different genotypes (Table 1).
                      Table 2

                      Salmonella virulence genes detected by PCR analysis

                      Gene

                      Function

                      Primer sequence (5 – 3)

                      bp

                      Reference

                      avrA

                      Inhibits the proinflammatory, antiapoptotic NF-kappa B pathway

                      CCTGTATTGTTGAGCGTCTGG

                      422

                      [8]

                        

                      AGAAGAGCTTCGTTGAATGTCC

                        

                      ssaQ

                      Secretion system apparatus protein, component of second T3SS

                      AATGAGCTGGGTAGGGTGTG

                      216

                      This study

                        

                      ATGCAACGCTAGCTGATGTG

                        

                      mgtC

                      Intramacrophage survival protein

                      TGACTATCAATGCTCCAGTGAAT

                      677

                      [8]

                        

                      ATTTACTGGCCGCTATGCTGTTG

                        

                      siiD

                      HLYD family secretion protein

                      GTTCATGGTCAGGGCGTTAT

                      416

                      This study

                        

                      GCAAGCAATGCGAGTTCTTT

                        

                      sopB

                      Translocated effector protein (phosphoinositide phosphatase) via T3SS

                      TAACGTCAATGGCAAACCAA

                      334

                      This study

                        

                      CCCTCATAAGCACTGGGAAA

                        

                      gipA

                      Peyer’s patch-specific virulence factor

                      GCAAGCTGTACATGGCAAAG

                      212

                      [9]

                        

                      GGTATCGGTGACGAACAAAT

                        

                      gogB

                      Type III-secreted substrate of the infection process

                      GCTCATCATGTTACCTCTAT

                      598

                      [10]

                        

                      AGGTTGGTATTTCCCATGCA

                        

                      sopE

                      Translocated T3SS effector protein

                      CGAGTAAAGACCCCGCATAC

                      363

                      [10]

                        

                      GAGTCGGCATAGCACACTCA

                        

                      gtgB

                      Translocated T3SS effector protein

                      TGCACGGGGAAAACTACTTC

                      436

                      [9]

                        

                      TGATGGGCTGAAACATCAAA

                        

                      sspH1

                      Salmonella secreted protein H1

                      TGCAGAAAAAGGGGAATACG

                      246

                      This study

                        

                      GCAGCCTGAAGGTCTGAAAC

                        

                      sspH2

                      Salmonella secreted protein H2

                      GCACAACTGGCTGAAGATGA

                      203

                      This study

                        

                      TTTCCCAGACGGAACATCTC

                        

                      gtgE

                      SPI2 type III secreted effector protein

                      AGGAGGAGTGTAAAGGT

                      1114

                      [11]

                        

                      GTAGAACTGGTTTATGAC

                        

                      sodC1

                      Periplasmmic Cu, Zn-superoxide dismutases

                      TATTGTCGCTGGTAGCTG

                      468

                      [11]

                        

                      CAGGTTTATCGGAGTAAT

                        

                      spvC

                      Spv region promotes rapid growth and survival within the host

                      ACTCCTTGCACAACCAAATGCGGA

                      571

                      [12]

                        

                      TGTCTTCTGCATTTCGCCACCATCA

                        

                      invA

                      Enables the bacteria to invade cells

                      ACAGTGCTCGTTTACGACCTGAAT

                      244

                      [12]

                        

                      AGACGACTGGTACTGATCGATAAT

                        

                      stfE

                      Minor fimbrial subunit of the Salmonella Typhi flagella

                      ATTTGGCAATGTGTTGACGA

                      185

                      This study

                        

                      TTTGCAGACGGATACCCAAT

                        

                      safC

                      Pilin outer membrane usher protein

                      CTCGCTGTCATTGAACTGGA

                      158

                      This study

                        

                      CACCGTGTGATGGTGAAGTC

                        

                      csgA

                      Major fimbrial subunit of thin curled fimbriae

                      GGATTCCACGTTGAGCATTT

                      212

                      This study

                        

                      CGGAGTTTTTAGCGTTCCAC

                        

                      ipfD

                      The Ipf fimbrial operon mediates adhesion to Peyer’s patches

                      TTCCCTCAATACGCAGGAAG

                      183

                      This study

                        

                      CTCAGGGCTGTGAACTCTCC

                        

                      bcfC

                      Bovine colonization factor, fimbrial usher

                      CAGCTTTTCATGACGCGATA

                      241

                      This study

                        

                      CAATGTCTCTGGTTGCGAGA

                        

                      stbD

                      Stability protein involved in a toxin-antitoxin system and in plasmid stability

                      GGCTGTAATATTCGCCGGTA

                      201

                      This study

                        

                      GCACGCCCTATTCCAGTAAA

                        

                      pefA

                      Major fimbrial subunit of the plasmid encoded fimbria

                      ACACGCTGCCAATGAAGTGA

                      450

                      [18]

                        

                      ACTGCGAAAGATGCCACAGA

                        

                      fimA

                      Type 1 major fimbrial unit

                      CCTTTCTCCATCGTCCTGAA

                      85

                      This study

                        

                      TGGTGTTATCTGCCTGACCA

                        

                      agfA

                      Aggregative fimbria A

                      GGATTCCACGTTGAGCATTT

                      312

                      [18]

                        

                      GTTGTTGCCAAAACCAACCT

                        
                      The 24 loci-genetic characterization was also extended to the S. Muenster and S. Give isolates to investigate their pathogenic potential because of their large presence in water buffalo calves. In addition they have already been reported to cause saepticemic salmonellosis in cattle and calves [14, 15]. The molecular results (Table 3) indicated that the loci invA, safC, bcfC, fimA and ssaQ were present in all the strains, the genes gipA, gogB, sspH2, sodC1, gtgE, spvC, stfE, ipfD and pefA were not found in any of these isolates, while the remaining loci were variably distributed, with frequency values ranging from 14-86%. In particular, the prophage genes were scarcely present (2 loci in the Muenster serovar, 1 locus in the Give serovar), the plasmidic spvC locus was absent in all the analyzed isolates, while the fimbrial genes and the SPI 1–5 genetic markers were discretely represented (6 loci for the former genes in both serovars, 5 and 4 loci for the latter genes in the serovar Muenster and Give, respectively). Moreover, the molecular profiles allowed to identify 6 different genotypes out of the 7 S. Muenster isolates, and 5 different genotypes out of the 7 S. Give isolates (Table 3).
                      Table 3

                      Virulotypes of the Salmonella Muenster and give isolates

                      Isolate #

                          

                      Genesa

                           

                      Genotype #

                       

                      gtgB

                      sopE

                      sspH1

                      csgA

                      stbD

                      agfA

                      avrA

                      mgtC

                      siiD

                      sopB

                       

                      S. Muenster

                                 

                      1885

                      -

                      +

                      -

                      +

                      +

                      -

                      +

                      +

                      +

                      +

                      1

                      67

                      +

                      +

                      -

                      -

                      -

                      -

                      +

                      -

                      -

                      -

                      2

                      15228

                      -

                      +

                      -

                      -

                      -

                      -

                      -

                      -

                      -

                      -

                      3

                      66761

                      -

                      +

                      -

                      -

                      -

                      -

                      -

                      -

                      -

                      -

                      3

                      72827

                      -

                      +

                      -

                      -

                      -

                      -

                      +

                      -

                      +

                      -

                      4

                      75822

                      +

                      +

                      -

                      -

                      -

                      -

                      -

                      -

                      -

                      -

                      5

                      66325

                      -

                      +

                      -

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      6

                      Freq. (%)

                      29

                      100

                      0

                      29

                      29

                      14

                      57

                      29

                      43

                      29

                       

                      S. Give

                                 

                      1139

                      -

                      -

                      -

                      -

                      +

                      -

                      +

                      +

                      +

                      -

                      1

                      364

                      -

                      -

                      +

                      -

                      +

                      -

                      +

                      +

                      +

                      -

                      2

                      18327

                      -

                      -

                      +

                      -

                      +

                      -

                      +

                      +

                      +

                      -

                      2

                      30877

                      -

                      -

                      +

                      -

                      +

                      -

                      +

                      -

                      -

                      -

                      3

                      2670

                      -

                      -

                      +

                      -

                      +

                      -

                      -

                      -

                      -

                      -

                      4

                      100739

                      -

                      -

                      +

                      +

                      +

                      +

                      +

                      +

                      +

                      -

                      5

                      82613

                      -

                      -

                      +

                      -

                      +

                      -

                      +

                      +

                      +

                      -

                      2

                      Freq. (%)

                      0

                      0

                      86

                      14

                      100

                      14

                      86

                      71

                      71

                      0

                       

                      a The following loci: invA, safC, bcfC, fimA and ssaQ were present in all the strains; the genes gipA, gogB, sspH2, sodC1, gtgE, spvC, stfE, ipfD and pefA were not found in any of these strains.

                      Our data confirm the high variability of the Typhimurium serovar [9, 10], mostly related to virulence factors, and highlight the high discriminating potential of the genotyping technique performed. Our data also suggest that monophasic Typhimurium strains are likely to possess a similarly high degree of genetic variability, particularly linked to virulence markers. Moreover, the presence of virulence markers in the isolated strains of monophasic S. Typhimurium, S. Muenster and S. Give could further support their pathogenic potential. The products of the genes included in the virulotyping assay performed here are known to be important during different stages of infection (Table 2). However, the distribution of these factors among the tested strains highlights the complexity and the variety of potential mechanisms used by Salmonella to induce disease in the host.

                      The avrA, ssaQ, mgtC, siiD, and sopB genes are genetic markers for the presence of the SPI 1–5 in all S. Typhimurium strains tested, although their presence does not necessarily implicate the presence of the entire SPI. SPIs are clusters of genes on the chromosome, likely to be horizontally acquired, and variably associated with enhanced invasion and intracellular survival within both phagocytic and non-phagocytic cells. In particular, SPI-5 has been largely associated with the ability to produce enteritis [5]. The S. Typhimurium strains included in this study all displayed the presence of the investigated SPI markers. Interestingly, these loci appeared widely distributed also among the serovars Muenster and Give. The sopE gene is known to favor the entry of Salmonella into host cells and its presence has been correlated with disease in humans [16] and with the epidemic potential of S. Typhimurium strains in cattle [17]. This gene was absent in all the S. Typhimurium strains included in the present study, while was present in all the S. Muenster strains analyzed.

                      The pefA (plasmid encoded fimbria), agfA (aggregative fimbria A) and spvC (Salmonella plasmid of virulence gene C) genes are all located on plasmids [18]. Five S. Typhimurium isolates tested in the current study possessed both pefA and spvC, two isolates were positive for only spvC, and three isolates were positive for only agfA (Table 1). These results confirm the presence of more than one virulence plasmid among S. Typhimurium strains isolated from diarrheic water buffalo calves, and suggest horizontal exchange of virulence factors. However, the loci pefA and spvC were absent in all the monophasic S. Typhimurium, S. Muenster and S. Give strains tested. Prophage genes are known to account for most of the variability of closely-related S. Typhimurium strains. Moreover, lysogenic bacteriophages promote changes in the composition of genomic DNA often altering the phenotype of the host [9, 10]. The prophage virulence genes included in this study exhibited a variable distribution among the isolates tested, thus suggesting synergistic and/or redundant effects of these loci on the pathogenicity of Salmonella, likely contributing to the phenotypic variability of this pathogen. These loci were mostly present in S. Typhimurium and monophasic S. Typhimurium rather than in S. Muenster and S. Give isolates. Fimbrial genes appeared widely distributed among all the serovars tested, particularly in S. Typhimurium strains, with frequency values ≥92%, except for the plasmid-borne pefA and agfA genes (with frequency values of 38% and 54%, respectively). These data are consistent with the essential functions of adhesion factors for the attachment and internalization processes that occur during pathogenesis.

                      To better characterize in vivo virulence, three strains representative of all S. Typhimurium isolates were chosen to perform mixed infections in mice. Animal experiments included the two strains exhibiting the highest and the lowest number of virulence factors (strains #92 and #112, respectively), and strain #16, carrying the same virulotype as strain #92, but that does not harbor the agfA locus (Table 1). In the competition assay, strain #92 outcompeted both strains #112 and #16 (CI 0.004; P<0.001, and CI 0.031; P<0.001, respectively). These results were confirmed in a gastrointestinal mouse model of infection, which better resembles the clinical form of salmonellosis in livestock. Using oral inoculation, in the competition assay, again strain #92 outcompeted both strains #112 and #16 (CI 0.009; P<0.001, and CI 0.186; P<0.01, respectively). Our data indicate that among those strains included in the experiment, strain #92 was the most virulent in mice. These competition assays in mice suggest a key role of the agfA gene coding for a thin aggregative fimbria involved in the colonization of host intestinal epithelial cells by attachment to glycoprotein or glycolipid receptors on epithelial cell surfaces. Indeed, the strain which was more virulent in in vivo experiments was characterized by a high number of virulence factors and by the presence of the agfA locus. Moreover, it was isolated from one of the subjects with necrotic-ulcerative enterocolitis.

                      The presence of this type of fimbria has been reported in clinical human and animal isolates of Salmonella[19, 20]. The data presented here suggest that agfA might increase bacterial pathogenicity. Nevertheless, we cannot reject the hypothesis that the mouse model chosen for in vivo experiments could have influenced the virulence phenotype of the tested strains originally isolated from water buffalo calves. Therefore, future studies will be necessary to exclude the possibility that the phenotypic differences observed among the tested Salmonellae are dependent on the animal model or on other virulence factors not included in this study. However, in vivo experiments carried out in mouse models represent a good preliminary source of information on the expression of traits associated with pathogenicity of Salmonella in mammalian species.

                      Conclusions

                      This study showed a significant (25%) prevalence of Salmonella spp. in water buffalo calves affected by gastroenteritis with lethal outcome. However, our results did not indicate the existence of a Salmonella serovar specifically adapted to water buffalo and highlighted that S. Typhimurium is the most frequently found serovar. The molecular and phenotypic characterization of the S. Typhimurium isolates provided evidence that within this serovar there are different pathotypes potentially responsible for different clinical syndromes, therefore requiring prophylaxis protocols including the use of specific vaccines for the effective control of salmonellosis in water buffalo calves and possible contamination of the food chain.

                      Methods

                      Bacterial strains and diagnostic methods

                      This study was carried out in the Campania region, Southern Italy, during 2008–2009, using samples taken from 248 water buffalo calves bred in 58 different farms. The animals were aged between 1–12 weeks old and were all affected by gastroenteritis with lethal outcome. During necropsy, the intestinal lesions were evaluated and the intestinal content of the involved sections was collected and tested for the presence of Salmonella spp. In addition, the presence of E. coli, Eimeria spp., Cryptosporidium spp., Giardia spp., Coronavirus, Rotavirus, and C. perfringens were also determined to investigate their association with Salmonella spp.

                      The isolation of Salmonella spp. was performed according to ISO 6579:2002 [21]. The isolated Salmonella spp. were serotyped according to the Kaufmann-White scheme [22]. Phage-typing of the isolated S. Typhimurium strains was performed by the Italian National Reference Centre for Salmonellosis (Istituto Zooprofilattico Sperimentale delle Venezie).

                      The presence of Rotavirus and Coronavirus was detected by polymerase chain reaction (PCR) amplification [23, 24]. Cryptosporidium spp. and Giardia spp. antigens were detected by chromatographic immunoassay (Oxoid, Basingstoke, UK). The presence of Eimeria spp. was examined by flotation technique using saturated saline [25]. E. coli and C. perfringens were isolated according to the protocol reported by Quinn et al. [2]. E. coli hemolytic activity was evaluated by growing colonies on blood agar base, while virulence factors (lt-heat-labile toxin, st-heat-stable toxin, stx1-Shiga toxin 1, stx2-Shiga-toxin 2, eae-intimin, cnf-cytotoxic necrotizing factor, and cdt-cytolethal distending toxin) were detected by molecular assays, as previously reported [2628].

                      DNA extraction and molecular assays

                      Bacterial DNA was extracted from 1 mL of overnight cultures using Chelex 100 Resin (BioRad, Hercules, CA) and used as the template for the PCR detection of genes listed in Table 2, as described previously [813, 18]. The primers used to amplify the genes sspH1, sspH2, ssaQ, sopB, siiD, stfE, safC, csgA, ipfD, bcfC, stbD, and fimA were designed using the Primer3 software (version 0.4.0; http://​frodo.​wi.​mit.​edu/​), and PCR was performed in a final volume of 25 μL containing HotStar Taq Master Mix (Qiagen, Valencia, CA) 1×, 0.4 μM each primer and 1 μL of extracted DNA. The thermal profile included an initial denaturation step at 95°C for 15 min, followed by 35 cycles at 95°C for 30 s, 58°C for 30 s, and 72°C for 1 min, and a final extension step at 72°C for 5 min. Amplification products were visualized under ultraviolet (UV) light after electrophoresis on 3% agarose gels and staining with SYBRsafe (Invitrogen, Carlsbad, CA).

                      Competition assays in mice

                      Groups of five age matched (8–10 weeks old) female BALB/c mice used in this study were purchased from Charles River (Calco, Italy). Three strains (S. Typhimurium #16, S. Typhimurium #92, S. Typhimurium #12), representative of the 13 genotypically characterized S. Typhimurium isolates, were selected for an in vivo analysis of virulence by using the Competitive Index (CI) resulting from mixed infections [29]. In particular, two strains were selected that exhibited the highest and lowest number of virulence factors (strains #92 and #112, respectively), and strain #16, carrying the same virulotype as strain #92, but without the locus agfA (Table 1).

                      Bacteria were grown overnight at 37°C in Brain Heart Infusion medium (Oxoid, Basingstoke, UK), washed, and diluted in sterile saline. Cultures were alternatively combined in a mixture of equivalent numbers (1:1 ratio) of two of the three selected strains (input). Mice were inoculated intraperitoneally (IP) with a dose of 2×104 bacteria or received 20 mg of streptomycin orally (200 μL of sterile solution or sterile saline) 24 h prior of being intragastrically administered with 2×107 bacteria. The number of colony-forming units (CFU) contained in the inocula were confirmed by plating serial dilutions and counting colony growth. At 4 (IP) or 7 (os) days after infection, mice were sacrificed, spleens were aseptically removed, and bacteria were counted by plating serial dilutions (output). The ratio of two strains in the input and in the output was evaluated by picking and transferring 200 colonies on selective plates. Antibiotics used were streptomycin and sulfonamide, for which strain 92 and strains 16 or 112 were naturally resistant. The CI was calculated using the formula: CI = output (strain A/strain B)/inoculum (strain A/strain B). Statistical differences between outputs and inputs were determined by Student’s t test. All animal handling and sampling procedures were performed under the conditions of the local ethics committee meeting the requirements of Italian legislation.

                      Declarations

                      Authors’ Affiliations

                      (1)
                      Istituto Zooprofilattico Sperimentale del Mezzogiorno
                      (2)
                      Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare, Istituto Superiore di Sanità
                      (3)
                      Dipartimento di Biologia, Università di Roma Tor Vergata
                      (4)
                      Dipartimento di Scienza degli Alimenti, Università degli Studi di Napoli Federico II

                      References

                      1. Fagiolo A, Roncoroni C, Lai O, Borghese A: Buffalo pathologies. In Buffalo Production and Research. Edited by: Borghese A. Rome: FAO Regional Office for Europe Inter-Regional Cooperative Research Network on Buffalo; 2005:249–296.
                      2. Quinn PJ, Markey B, Leonard FC, FitzPatrick ES, Fanning S, Hartigan PJ: Veterinary microbiology and Microbial disease. 2nd edition. West Sussex, UK: Wiley Blackwell; 2011:143–156.
                      3. Adlakha SC, Sharma SN: Infectious diseases. In World Animal Science C6, Buffalo Productions. Edited by: Tulloh NM, Holmes JHG. Parkville: Elsevier; 1992:271–303.
                      4. Foster DM, Smith GW: Pathophysiology of diarrhea in calves. Vet Clin Food Anim 2009, 25:13–36.View Article
                      5. Barrow PA, Jones MA, Thomson N: Salmonella. In Pathogenesis of bacterial infections in animals. Edited by: Gyles CL, Prescott JF, Songer JG, Thoen CO. Ames: Blackwell Publishing; 2010:231–265.View Article
                      6. Amrousi SE, Nefie EK, Rehewi ME, Mottilib AA: Studies on enteritis in buffalo calves. Assint J Egypt Vet Med Ass 1971, 31:219–225.
                      7. EFSA Panel on Biological Hazards (BIOHAZ): Scientific Opinion on monitoring and assessment of the public health risk of “ Salmonella Typhimurium-like” strains. EFSA J 2010, 8:1826–1873.
                      8. Huehn S, La Ragione RM, Anjum M, Saunders M, Woodward MJ, Bunge C, Helmuth R, Hauser E, Guerra B, Beutlich J, Brisabois A, Peters T, Svensson L, Madajczak G, Litrup E, Imre A, Herrera-Leon S, Mevius D, Newell DG, Malorny B: Virulotyping and antimicrobial resistance typing of Salmonella enterica serovars relevant to human health in Europe. Foodborne Pathog Dis 2009, 7:523–535.View Article
                      9. Mikasova E, Drahovska H, Szemes T, Kuchta T, Karpiskova R, Sasik M, Turna J: Characterization of Salmonella enterica serovar Typhimurium strains of veterinary origin by molecular typing methods. Vet Microbiol 2005, 109:113–120.PubMedView Article
                      10. Drahovska H, Mikasova E, Szemes T, Ficek A, Sasik M, Majtan V, Turna J: Variability in occurrence of multiple prophage genes in Salmonella Typhimurium strains isolated in Slovack Republic. FEMS Microbiol Lett 2007, 270:237–244.PubMedView Article
                      11. Bacciu D, Falchi G, Spazzini A, Bossi L, Marogna G, Sisinnio Leori G, Rubino S, Uzzau S: Transposition of the heat-stable toxin astA gene into a Gifsy-2-related prophage of Salmonella enterica serovar abortusovis. J Bacteriol 2004, 186:4568–4574.PubMedView Article
                      12. Chiu CH, Ou JT: Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, invA and spvC , by an enrichment broth culture-multiplex PCR combination assay. J Clin Microbiol 1996, 34:2619–2622.PubMed
                      13. Heithoff DM, Shimp WR, Lau PW, Badie G, Enioutina EY, Daynes RA, Byrne BA, House JK, Mahan MJ: Human Salmonella clinical isolates distinct from those of animal origin. Appl Environ Microbiol 2008, 74:1757–1766.PubMedView Article
                      14. Radke BR, McFall M, Radostits SM: Salmonella Muenster infection in a dairy herd. Can Vet J 2002, 43:443–453.PubMed
                      15. Higgins R, Désilets A, Cantin M, Messier S, Khakhria R, Ismaïl J, Mulvey MR, Daignault D, Caron H: Outbreak of Salmonella Give in the province of Quebec. Can Vet J 1997, 38:780–781.PubMed
                      16. Hopkins KL, Threlfall EJ: Frequency and polymorphism of sopE in isolates of Salmonella enterica belonging to the ten most prevalent serotypes in England and Wales. J Med Microbiol 2004, 53:539–543.PubMedView Article
                      17. Mirold S, Rabsch W, Rohde M, Stender S, Tschäpe H, Rüssmann H, Igwe E, Hardt WD: Isolation of a temperate bacteriophage encoding the type III effector protein SopE from an epidemic Salmonella typhimurium strain. Proc Natl Acad Sci USA 1999, 96:9845–9850.PubMedView Article
                      18. Smith KP, George J, Cadle KM, Kumar S, Aragon SJ, Hernandez RL, Jones SE, Floyd JL, Varela MF: Elucidation of antimicrobial susceptibility profiles and genotyping of Salmonella enterica isolates from clinical cases of salmonellosis in New Mexico in 2008. World J Microbiol Biotechnol 2010, 26:1025–1031.PubMedView Article
                      19. Doran JL, Collinson SK, Burian J, Sarlós G, Todd EC, Munro CK, Kay CM, Banser PA, Peterkin PI, Kay WW: DNA-based diagnostic tests for Salmonella species targeting agfA , the structural gene for thin, aggregative fimbriae. J Clin Microbiol 1993, 31:2263–2273.PubMed
                      20. Pasmans F, Martel A, Boyen F, Vandekerchove D, Wybo I, Immerseel FV, Heyndrickx M, Collard JM, Ducatelle R, Haesebrouck F: Characterization of Salmonella isolates from captive lizards. Vet Microbiol 2005, 110:285–291.PubMedView Article
                      21. UNI EN ISO 6579: Annex D “Detection of Salmonella spp. in animal feces and in environmental samples from primary production stage”. 2002.
                      22. Grimont PAD, Weill FX: Antigenic formulae of the Salmonella serovars. 9th edition. Paris: WHO Collaborating Centre for Reference and Research on Salmonella; 2007:1–166.
                      23. Stephensen CB, Casebolt DB, Gangopadhyay NN: Phylogenetic analysis of a highly conserved region of the polymerase gene from 11 coronaviruses and development of a consensus polymerase chain reaction assay. Virus Res 1999, 60:181–189.PubMedView Article
                      24. Logan C, O’Leary JJ, O’Sullivan N: Real-time reverse transcription-PCR for detection of rotavirus and adenovirus as causative agents of acute viral gastroenteritis in children. J Clin Microbiol 2006, 44:3189–3195.PubMedView Article
                      25. Hendrix CM: Internal parasites In Laboratory procedures for veterinary technicians. 5th edition. Edited by: Hendrix CM, Sirois M. St. Louis: Elsevier; 2007:81–229.
                      26. Toth I, Hérault F, Beutin L, Oswald E: Production of cytolethal distending toxins by pathogenic Escherichia coli strains isolated from human and animal sources: establishment of the existence of a new cdt variant (type IV). J Clin Microbiol 2003, 41:4285–4291.PubMedView Article
                      27. Vidal M, Kruger E, Durán C, Lagos R, Levine M, Prado V, Toro C, Vidal R: Single multiplex PCR assay to identify simultaneously the six categories of diarrheagenic Escherichia coli associated with enteric infections. J Clin Microbiol 2005, 43:5362–5365.PubMedView Article
                      28. Borriello G, Lucibelli MG, De Carlo E, Auriemma C, Cozza D, Ascione G, Scognamiglio F, Iovane G, Galiero G: Characterization of enterotoxigenic E. coli (ETEC), Shiga-toxin producing E. coli (STEC) and necrotoxigenic E. coli (NTEC) isolated from diarrhoeic Mediterranean water buffalo calves ( Bubalus bubalis ). Res Vet Sci 2012, 93:18–22.PubMedView Article
                      29. Beuzón CR, Holden DW: Use of mixed infections with Salmonella strains to study virulence genes and their interactions in vivo. Microbes Infect 2001, 3:1345–1352.PubMedView Article

                      Copyright

                      © Borriello et al.; licensee BioMed Central Ltd. 2012

                      This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                      Advertisement