Recombinant porcine norovirus identified from piglet with diarrhea

  • Quan Shen1, 3,

    Affiliated with

    • Wen Zhang1,

      Affiliated with

      • Shixing Yang1,

        Affiliated with

        • Zhibiao Yang1,

          Affiliated with

          • Yan Chen2,

            Affiliated with

            • Li Cui2,

              Affiliated with

              • Jianguo Zhu2 and

                Affiliated with

                • Xiuguo Hua2Email author

                  Affiliated with

                  BMC Veterinary Research20128:155

                  DOI: 10.1186/1746-6148-8-155

                  Received: 6 January 2011

                  Accepted: 22 August 2012

                  Published: 3 September 2012

                  Abstract

                  Background

                  Noroviruses (NoVs) are members of the family Caliciviridae and are emerging enteric pathogens of humans and animals. Some porcine NoVs are genetically similar to human strains and are classified into GII, like most epidemic human NoVs. So far, PoNoV have been exclusively detected in fecal samples of adult pig without clinical signs.

                  Results

                  Result showed that 2 of the 12 evaluated fecal samples were positive for PoNoVs, one of which was positive for PoNoV alone, and the other was coinfected with porcine circovirus and PoNoV. Phylogenetic and recombination analysis showed that the PoNoV positive alone strain was a recombinant new genotype strain. Experimental infection of miniature pigs with fecal suspensions confirmed that this strain can cause gastroenteritis in piglets.

                  Conclusion

                  This is the first report that recombinant new genotype PoNoV exised in pig herd of China, which cause diarrhea in pigs in nature condition. This find raised questions about the putative epidemiologic role of PoNoV.

                  Keywords

                  Porcine norovirus Recombinant New genotype Gastroenteritis

                  Background

                  Noroviruses (NoVs) are members of the family Caliciviridae and are emerging enteric pathogens of humans and animals [1, 2]. They are small, non-enveloped viruses of 27–38 nm in diameter and possess a single-stranded, positive-sense genomic RNA. NoVs genome is 7.3-7.7 kb in length and contains 3 open reading frames (ORFs) [3]. ORF1 encodes a polyprotein that is autocatalytically cleaved to produce several proteins, including RNA-dependent RNA-polymerase (RdRp) and other non-structural proteins [4]. ORF2 encodes the major capsid protein, and ORF3 encodes for a minor structural protein [5]. NoVs have been isolated from humans and several species of animals, including swine, canine, bovine, murine and lion [68]. Based on sequence analyses comprising conserved regions within the RdRp and the capsid genes, NoVs are divided into 5 genogroups (GI-GV) and further subdivided into 27 genotypes [9]. Human NoVs are located in GI, GII and GIV. GII contains 19 genotypes, and porcine strains are found in GII-11, -18 and -19 [10]. Some porcine NoVs are genetically related to human strains and are classified into GII, which contains most epidemic strains of NoVs in human. Some potential NoVs recombinant strains have been identified [10, 11], which raises public health concerns regarding their potential for zoonotic transmission. To date, PoNoV have been exclusively detected in fecal samples of adult pig without clinical signs.

                  Methods

                  Specimens

                  Twelve fecal samples from piglets with diarrhea and no accurate of etiology were collected from three commercial pig farms in a Shanghai suburb, from May to August, 2009. In order to avoid sample contamination, specimens were obtained directly from the pig anus and disposable materials were used during sampling. Stool samples were freshly collected and immediately converted to 10% (w/v) suspensions in PBS (0.01 M phosphate, pH 7.2-7.4, 0.15 M NaCl,) for RNA and DNA extraction.

                  RNA and DNA extraction

                  RNA was extracted from 200ul of 10% fecal suspension by using the TRIzol reagent (Invitrogen, USA) following the manufacturer’s instructions. RNA pellets were dissolved in 25ul RNase-free water and reverse transcription was performed immediately. DNA was extracted using The QIAamp DNA Stool Mini Kit (QIAGEN, Germany) according to the manufacturer’s instructions.

                  RT-PCR or PCR

                  RT-PCR or PCR assays with different primer sets for the detection of PoNoV, and common viruses that can cause pig diarrhea including porcine circovirus type 2, porcine rotavirus, porcine transmissible gastroenteritis virus, porcine sapovirus, and porcine epidemic diarrhea virus were performed as previously described [1214]. The amplicons were analyzed by 1% agarose gel electrophoresis in TAE buffer, followed by staining with ethidium bromide (0.5 μg/ml) and visualization under UV light.

                  Whole genome amplification

                  The 3-kb 3end fragment of pNoVs-Ch6 was amplified with primers p290 and VN3T20 [10]. To amplify the remaining sequence, 6 sets of primers (Table 1) were designed based on the entire PoNoV genome sequence (AB126320) available in GenBank. Reverse transcription was carried out at 42°C for 1 h with 1 μl (200 units) of AMV Reverse Transcriptase (TakaRa, Japan) and 1 μl (25 mM) of antisense primer. The PCR parameters of all amplification reactions included an initial incubation at 95°C for 5 min, followed by 39 cycles of denaturation at 94°C for 1 min, annealing for 1 min at a temperature varied according to the Tm of different primers, and extension at 72°C for 1.5 min, with a final incubation at 72°C for 7 min. PCR products were purified using the Axyprep DNA Gel Extraction Kit (AXYGEN, USA). The purified PCR products were ligated into PMD18-T vector (TakaRa, Japan) using T4 DNA ligase (TakaRa, Japan) at 16°C for 2 h. The recombinant plasmid was transformed into DH5α competent Escherichia coli cells (TakaRa, Japan). Three of the positive clones were sequenced.
                  Table 1

                  Primers designed to amplify the remaining sequence of pNoVs-Ch6

                  Primer name

                  Nucleotide position

                  Nucleotide sequence (5-3)

                  PNoV1F

                  725-744

                  ACCTGTCCCTACAGTGGATG

                  PNoV1R

                  1494-1513

                  ATATGAGTTTTGCCTATACC

                  PNoV2F

                  1404-1425

                  ATCTCAGCAGCCAGGTCGCTCC

                  PNoV2R

                  2154-2173

                  AACCCATACCTATTGTCAGC

                  PNoV3F

                  2107-2126

                  TCTACAACTTCGATGTGGAC

                  PNoV3R

                  2826-2845

                  TGACGGAGTCTCATCTCATC

                  PNoV4F

                  2744-2762

                  CGAGGAGTACCTCCGTGAC

                  PNoV4R

                  3552-3571

                  TGATTCTCACCACCCTCCAG

                  PNoV5F

                  3525-3543

                  ACTCAGGGTCCTGATGGTG

                  PNoV5R

                  4298-4318

                  TGCCTCTCTGTTGGGTGGAG

                  PNoV6F

                  4261-4279

                  ATACCTACCACTTTGATGC

                  PNoV6R

                  4884-4902

                  ATGAGGCTTCTCCCAGCAGG

                  5endF

                  1-23

                  GTGAAATGAAGATGGCGTCTAAC

                  5endR

                  761-780

                  ATAGAATCACGTTGGCAACC

                  3endF1(external forward primer)

                  7009-7031

                  ACTGGAATGGCACGAGATACTGG

                  5endF2(internal forward primer)

                  7193-7212

                  ACTCTATGGGTACCTCTAG

                  5endR

                   

                  TTTTTTTTT

                  Position and nucleotide sequence of oligonucleotide primers for PCR. The nucleotide position is in accordance with AB126320. In the primer names, F and R mean sense primer and anti-sense primer, respectively.

                  Sequence and recombination analysis

                  Similarity searches of the sequences were carried out in BLAST (http://​www.​ncbi.​nlm.​nih.​gov/​BLAST/​). After a multiple alignment with CLUSTAL W (version 1.4), the phylogenetic relationship of the strains in the present study and the reference isolates were assessed using the software MEGA Version 4.0. For analysis in MEGA, Jukescantor (JC) distance was utilized, employing the Neighbor joining (NJ) algorithm [15]. The reliability of different phylogenetic groupings was evaluated by using the bootstrap test (1000 bootstrap replications) available in MEGA. The identification of recombinants was performed by using the Recombination Detection Program (http://​darwin.​uvigo.​es/​rdp/​rdp.​html) [16]. Prototype NoVs strains used as references in the analysis and their GenBank accession numbers and source of origin are marked in the phylogenetic tree (Figure 1).
                  http://static-content.springer.com/image/art%3A10.1186%2F1746-6148-8-155/MediaObjects/12917_2011_471_Fig1_HTML.jpg
                  Figure 1

                  Phylogenetic analysis of the amino acid sequences of pNoVs-Ch6 and other NoVs. Bootstrap values, expressed as percentages of 1000 replications, are given at the branch points. GenBank accession numbers for the reference strains are marked at each branch points. Tree (A) was constructed based on the complete capsid region. Tree (B) was constructed based on the RdRp region. Strains designation follows the outlines of Wang et al. [10] and Zheng et al. [9].

                  Animals

                  Eight 15-day old specific-pathogen-free (SPF) miniature pigs were purchased from Experimental Animal Center, School of Agricultural and Biology, Shanghai Jiaotong University (Shanghai, China), and maintained in a pathogen-free animal facility. This animal experiment was approved by the IACUC with a permit number of IACUC-2009-S-0202, which complies with the National Institute of Health Guide for the Care and Use of Laboratory Animals.

                  Experimental infection

                  The pNoVs-Ch6 fecal specimen was converted to 20% (wt/vol) suspensions in phosphate-buffered saline (PBS) (0.01 M, pH 7.4) and clarified by centrifugation at 10,000 g for 10 min. The supernatant was then subjected to purification by passage through microfilters with a pore size of 0.22 μm (Millipore, Japan) to remove possible bacteria and parasites. A 1.5 ml aliquot of supernatant was used to infect five 15-day old piglets through oral inoculation. Another three piglets were only inoculated with PBS as controls. The piglets were investigated every 4 hours during the first day, and fecal samples were collected from each piglet every day. For the experimental group, one piglet was euthanized at post-inoculation day (PID) 1, 2, 4, 6, 10; meanwhile, one was euthanized at PID 1, 4, 10 for the control group. The intestinal contents were collected for RNA testing using RT-PCR, and intestinal segments were excised and immediately immersed in the different fixatives for histological examination. Tissues for histological examination were fixed in 10% neutral buffered formalin, routinely processed, sectioned at a thickness of 7 μm, and stained with hematoxylin and eosin. The tissue sections were examined and compared with negative controls.

                  Results

                  Result of PoNoV detection

                  Result of detection indicated that two of the fecal samples were positive for PoNoV, one of which was coinfected with porcine circovirus. The others were negative for PoNoV, porcine circovirus type 2, porcine rotavirus, porcine transmissible gastroenteritis virus, porcine sapovirus, and porcine epidemic diarrhea virus. The fecal sample that was positive for only PoNoV was selected for further genome amplification and experimental infection.

                  Genome organization and recombination analysis

                  The entire genome of this PoNoV strain (named pNoVs-Ch6, GenBank accession number: HQ392821) consisted of 7531 nucleotides, excluding the poly (A) tail. Similar to previously reported NoVs strains, pNoVs-Ch6 has three open reading frames (ORFs), encoding 1693, 547 and 253 amino acids (aa), respectively. It shared 88% nucleotide homology with AB126320 over the entire genome sequence. The highest nucleotide homology over the RdRp sequence was shared with AB126320 (89%) and then with an American porcine strain AY823303 (88%).

                  A phylogenetic tree based on the predicted amino acid sequence of the complete capsid region showed that pNoVs-Ch6 was separated from known porcine GII strains (GII-11, GII-18 and GII-19) forming a new branch by itself (Figure 1A), which suggested that this strain may represent a novel genotype in GII group. However, phylogenetic analysis based on the RdRp region gave a different grouping result, where pNoVs-Ch6 was grouped into the GII-11 cluster (Figure 1B). This finding suggested that this virus strain may simultaneously be a recombinant. To confirm the finding and detect the breakpoint where the recombination event occurred, we performed recombination analysis based on 3′end RdRp and the capsid sequence of pNoVs-Ch6 as the query sequence, and AY823303/GII-11 and AY823306/GII-19 as the background sequences using RPD software. Results indicated that the breakpoint located in the RdRp-capsid junction region, and the major parent was AY823303 (Figure 2). The minor parent was not found which may be due to the limited number of NoVs sequences available in GenBank, though AY823306 had a high similarity with the query strain over a short fragment (Figure 2).
                  http://static-content.springer.com/image/art%3A10.1186%2F1746-6148-8-155/MediaObjects/12917_2011_471_Fig2_HTML.jpg
                  Figure 2

                  Identification of recombinant pNoVs-Ch6 strain. BOOTSCAN evidence for the recombination origin on the basis of pairwise distance, modeled with a window size 200, step size 25, and 100 Bootstrap replicates.

                  Experimental infection of miniature pigs with PoNoV positive fecal suspensions

                  Our results showed that all of the five piglets in the experimental group indicated evident symptoms of mild to moderate diarrhea at 0.5-1 PID. The clinical signs persisted for 2 to 6 days, and no piglet died. All of the fecal samples and intestinal contents of the experimental group piglets were positive for NoVs RNA. Mild to moderate villous atrophy, mild to moderate and multifocal villous fusion were observed in the small intestine of experimental group pigs that were euthanatized from PID 6 to PID 10 (Figure 3). The three piglets in the control groups showed no clinical symptoms and tested negative for NoVs RNA.
                  http://static-content.springer.com/image/art%3A10.1186%2F1746-6148-8-155/MediaObjects/12917_2011_471_Fig3_HTML.jpg
                  Figure 3

                  Histological lesions in the duodenum or jejunum of piglets following oral inoculation with NoVs or PBS. Hematoxylin and eosin stain. A, Normal-appearing, long villi of the duodenum from a PBS-inoculated pig; B, Villi of the duodenum showing mild villous atrophy from the NoVs-inoculated pig; C, Normal-appearing, long villi of the jejunum from a PBS-inoculated pig; D, Villi of the jejunum showing mild villous atrophy from the NoVs inoculated pig. Bar = 10 μm.

                  Discussion

                  NoVs has been detected in a wide range of species, including humans, porcine, mice, cows and lions. Because PoNoV are genetically and antigenically related to human GII NoVs, there are public health concerns of potential cross-species transmission and animal reservoirs for NoVs related to human NoVs [10, 17]. So far, PoNoV have been exclusively detected in fecal samples of adult pig without clinical signs [18, 19], though in experiments with gnotobiotic piglets mild diarrhea occurred [10]. In the current study, gastroenteritis in piglets caused by a PoNoV strain was reported. Experimental infection of miniature pigs with PoNoV positive fecal suspensions confirmed that this virus strain can cause gastroenteritis in pigs. To our knowledge, this study is the first identification of a PoNoV strain that cause piglets gastroenteritis under near natural conditions.

                  The genome of RNA viruses often undergoes recombination and segmentation [20].

                  Recombination is a driving force of viral evolution and has been reported for many single-stranded RNA viruses, including NoVs. It has been reported that the recombination of influenza virus leads to generation of a new strain and increases the biological fitness of the virus and its pathogenicity [1].

                  Previous reports have shown that, in the genome of NoVs, recombination mostly occurs at the junction point of ORF1 and ORF2 which is referred to as ‘hot spot’ [2123]. Results of phylogenetic analysis and recombination identification showed that pNoVs-Ch6 was a recombinant strain, and the breakpoint located in the RdRp-capsid junction region like most other NoVs recombination events. To the best of our knowledge, this is the first report of recombinant PoNoV in China.

                  The detection of PoNoV that can cause gastroenteritis in piglets from commercial pig farms under natural conditions, on one hand, raises questions about the putative epidemiologic role of PoNoV, and, on the other hand, this kind of infectious strain also can be used to improve research such as virus replication, vaccine development, which has been impeded by the lack of a cell culture system for the propagation of human NoVs. Whether the recombination increased the virulence of PoNoV still needs further research.

                  Conclusion

                  In conclusion, the results in this study demonstrated that recombinant new genotype PoNoV exised in pig herd of China, which cause diarrhea in pigs in nature condition. This find raised questions about the putative epidemiologic role of PoNoV.

                  Declarations

                  Acknowledgments

                  We thank Kelly Scheuer for assistance in linguistic revision of the manuscript.This work was supported by grants from the National Natural Science Foundation of China No. 31070132 and No.31270186, Key Project of Shanghai Science and Technology Committee of China under Grant No.10JC1406500, Natural Science Foundation of Jiangsu Province No.BK2012289, Research Fund for the Doctoral Program of Higher Education of China No. 20113227120008, and the Professional Research Foundation for Advanced Talents of Jiangsu University.

                  Authors’ Affiliations

                  (1)
                  School of Medical Science and Laboratory Medicine, Jiangsu University
                  (2)
                  Key laboratory of Veterinary Biotechnology, School of Agriculture and Biology, Shanghai JiaoTong University
                  (3)
                  Food Animal Health Research Program, Ohio Agricultural Research and Development Center, The Ohio State University

                  References

                  1. Fields BN, Knipe DM, Howley PM: Fields virology. 5th edition. Wolters Kluwer Health /Lippincott Williams & Wilkins, Philadelphia; London; 2007.
                  2. Liu BL, Lambden PR, Gunther H, Otto P, Elschner M, Clarke IN: Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J Virol 1999,73(1):819–825.PubMed
                  3. Jiang X, Wang M, Wang K, Estes MK: Sequence and genomic organization of Norwalk virus. Virology 1993,195(1):51–61.PubMedView Article
                  4. Sosnovtsev SV, Belliot G, Chang KO, Prikhodko VG, Thackray LB, Wobus CE, Karst SM, Virgin HW, Green KY: Cleavage map and proteolytic processing of the murine norovirus nonstructural polyprotein in infected cells. J Virol 2006,80(16):7816–7831.PubMedView Article
                  5. Belliot G, Sosnovtsev SV, Mitra T, Hammer C, Garfield M, Green KY: In vitro proteolytic processing of the MD145 norovirus ORF1 nonstructural polyprotein yields stable precursors and products similar to those detected in calicivirus-infected cells. J Virol 2003,77(20):10957–10974.PubMedView Article
                  6. Mattison K, Shukla A, Cook A, Pollari F, Friendship R, Kelton D, Bidawid S, Farber JM: Human noroviruses in swine and cattle. Emerg Infect Dis 2007,13(8):1184–1188.PubMedView Article
                  7. Martella V, Campolo M, Lorusso E, Cavicchio P, Camero M, Bellacicco AL, Decaro N, Elia G, Greco G, Corrente M, et al.: Norovirus in captive lion cub (Panthera leo). Emerg Infect Dis 2007,13(7):1071–1073.PubMedView Article
                  8. Martella V, Lorusso E, Decaro N, Elia G, Radogna A, D’Abramo M, Desario C, Cavalli A, Corrente M, Camero M, et al.: Detection and molecular characterization of a canine norovirus. Emerg Infect Dis 2008,14(8):1306–1308.PubMedView Article
                  9. Zheng DP, Ando T, Fankhauser RL, Beard RS, Glass RI, Monroe SS: Norovirus classification and proposed strain nomenclature. Virology 2006,346(2):312–323.PubMedView Article
                  10. Wang QH, Han MG, Cheetham S, Souza M, Funk JA, Saif LJ: Porcine noroviruses related to human noroviruses. Emerg Infect Dis 2005,11(12):1874–1881.PubMedView Article
                  11. Farkas T, Nakajima S, Sugieda M, Deng X, Zhong W, Jiang X: Seroprevalence of noroviruses in swine. J Clin Microbiol 2005,43(2):657–661.PubMedView Article
                  12. Jiang X, Huang PW, Zhong WM, Farkas T, Cubitt DW, Matson DO: Design and evaluation of a primer pair that detects both Norwalk- and sapporo-like caliciviruses by RT-PCR. J Virol Methods 1999,83(1–2):145–154.PubMedView Article
                  13. Jeong C, Park SI, Park SH, Kim HH, Park SJ, Jeong JH, Choy HE, Saif LJ, Kim SK, Kang MI, et al.: Genetic diversity of porcine sapoviruses. Vet Microbiol 2007,122(3–4):246–257.PubMedView Article
                  14. Yang JS, Song DS, Kim SY, Lyoo KS, Park BK: Detection of porcine circovirus type 2 in feces of pigs with or without enteric disease by polymerase chain reaction. J Vet Diagn Invest 2003,15(4):369–373.PubMedView Article
                  15. Kumar S, Tamura K, Nei M: MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 2004,5(2):150–163.PubMedView Article
                  16. Martin D, Rybicki E: RDP: detection of recombination amongst aligned sequences. Bioinformatics 2000,16(6):562–563.PubMedView Article
                  17. Guo M, Chang KO, Hardy ME, Zhang Q, Parwani AV, Saif LJ: Molecular characterization of a porcine enteric calicivirus genetically related to Sapporo-like human caliciviruses. J Virol 1999,73(11):9625–9631.PubMed
                  18. van Der Poel WH, Vinje J, van Der Heide R, Herrera MI, Vivo A, Koopmans MP: Norwalk-like calicivirus genes in farm animals. Emerg Infect Dis 2000,6(1):36–41.PubMedView Article
                  19. Scipioni A, Mauroy A, Vinje J, Thiry E: Animal noroviruses. Vet J 2008,178(1):32–45.PubMedView Article
                  20. Domingo E, Holland JJ: RNA virus mutations and fitness for survival. Annu Rev Microbiol 1997, 51:151–178.PubMedView Article
                  21. Ambert-Balay K, Bon F, Le Guyader F, Pothier P, Kohli E: Characterization of new recombinant noroviruses. J Clin Microbiol 2005,43(10):5179–5186.PubMedView Article
                  22. Bull RA, Hansman GS, Clancy LE, Tanaka MM, Rawlinson WD, White PA: Norovirus recombination in ORF1/ORF2 overlap. Emerg Infect Dis 2005,11(7):1079–1085.PubMedView Article
                  23. Jiang X, Espul C, Zhong WM, Cuello H, Matson DO: Characterization of a novel human calicivirus that may be a naturally occurring recombinant. Arch Virol 1999,144(12):2377–2387.PubMedView Article

                  Copyright

                  © Shen et al.; licensee BioMed Central Ltd. 2012

                  This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                  Advertisement