Open Access

SNR analysis: molecular investigation of an anthrax epidemic

  • Giuliano Garofolo1Email author,
  • Andrea Ciammaruconi2,
  • Antonio Fasanella1,
  • Silvia Scasciamacchia1,
  • Rosanna Adone3,
  • Valentina Pittiglio2 and
  • Florigio Lista2
BMC Veterinary Research20106:11

DOI: 10.1186/1746-6148-6-11

Received: 9 September 2009

Accepted: 28 February 2010

Published: 28 February 2010

Abstract

Background

In Italy, anthrax is endemic but occurs sporadically. During the summer of 2004, in the Pollino National Park, Basilicata, Southern Italy, an anthrax epidemic consisting of 41 outbreaks occurred; it claimed the lives of 124 animals belonging to different mammal species. This study is a retrospective molecular epidemiological investigation carried out on 53 isolates collected during the epidemic. A 25-loci Multiple Locus VNTR Analysis (MLVA) MLVA was initially performed to define genetic relationships, followed by an investigation of genetic diversity between epidemic strains through Single Nucleotide Repeat (SNR) analysis.

Results

53 Bacillus anthracis strains were isolated. The 25-loci MLVA analysis identified all of them as belonging to a single genotype, while the SNR analysis was able to detect the existence of five subgenotypes (SGTs), allowing a detailed epidemic investigation. SGT-1 was the most frequent (46/53); SGTs 2 (4/53), 3 (1/53) 4 (1/53) and 5 (1/53) were detected in the remaining seven isolates.

Conclusions

The analysis revealed the prevalent spread, during this epidemic, of a single anthrax clone. SGT-1 - widely distributed across the epidemic area and present throughout the period in question - may, thus, be the ancestral form. SGTs 2, 3 and 4 differed from SGT-1 at only one locus, suggesting that they could have evolved directly from the latter during the course of this epidemic. SGT-5 differed from the other SGTs at 2-3 loci. This isolate, thus, appears to be more distantly related to SGT-1 and may not be a direct descendant of the lineage responsible for the majority of cases in this epidemic. These data confirm the importance of molecular typing and subtyping methods for in-depth epidemiological analyses of anthrax epidemics.

Background

In the region of Basilicata, Southern Italy, anthrax outbreaks are typically isolated, self containing, and involve unvaccinated herbivores. Epidemics are rare, and often occur when a rainy spring is followed by a dry summer [15]. During the spring and summer of 2004, as a result of such weather conditions in the Pollino National Park, an anthrax epidemic occurred. The affected area included 13 towns and involved 41 farms over an area of about 900 Km2, with a livestock population numbering about 7,000 cattle and 33,000 between sheep and goats. In 40 days, 81 cattle, 15 sheep, nine goats, eleven horses and eight red deer died (Figure 1). The anthrax epidemic evolved in three different phases. The first, counting 26 outbreaks, was the most critical. The second and third phases, with eight and six outbreaks, respectively, were less severe.
https://static-content.springer.com/image/art%3A10.1186%2F1746-6148-6-11/MediaObjects/12917_2009_Article_191_Fig1_HTML.jpg
Figure 1

Map of the Pollino national Park 2004 anthrax epidemic. Geographical representation (GIS data) of the epidemic, with its 41 outbreaks. The five subgenotypes are marked in different color fonts. ©2009 Google - Map data ©2009 Tele Atlas.

An additional outbreak preceded the epidemic by about one month [6]. Several epidemiological factors may have contributed to this phenomenon. In this, as in other endemic areas, spores resulting from previous outbreaks may remain in the soil, thus facilitating the spread of anthrax among livestock through grazing [7, 8]. In addition, anthrax infected carcasses are seldom removed. These carcasses are not isolated from the wild animals populating the Pollino National Park (deer, wild boars), resulting in a persistent source of infection in the environment [2]. Furthermore, the abundance, at this time of year, of both biting (e.g. tabanid) and non biting flies, which may act as mechanical vectors, could also have contributed to the persistence of anthrax [914].

Genetically, B. anthracis is a relatively homogeneous bacteria species. Not surprisingly, then, discriminating between strains isolated from epidemiologically linked outbreaks is not an easy task [15]. Different studies typed and differentiated B. anthracis isolates using Single Nucleotide Polymorphisms (SNP) analysis and Multiple Locus VNTR analysis (MLVA) [1622]. In an epidemic, however, these methodologies are not likely to find genetic variation. The Single Nucleotide Repeats (SNR) analysis described by Stratilo et al. increases the likelihood of differentiating closely related isolates [23]. Unfortunately, due to the presence of poly-A sequences, such polymorphisms are difficult to detect both with electorphoretic fragment analysis and with direct sequencing.

In this study, a retrospective molecular epidemiological investigation was performed, comparing 25-loci MLVA and two SNR analyses. We applied the modified SNR technique described by Kenefic et al. (KEN-MTD) as well as Stratilo's original SNR method (STR-MTD), selecting the four loci with the highest diversity indices (D = 0.57-0.90; where D = 1-Σ [allele frequency]2) [23, 24]. The SNR primer panels used have two loci in common (CL33, CL12) and two distinct loci (STR-MTD: CL1, CL37) (KEN-MTD: CL10, CL35). Two different genetic analyzers (DNA sequencers) were used to verify results. This was done to address the technical difficulty in correct allele assignment.

Results

MLVA 25

The 25-loci MLVA analysis classified all 53 B. anthracis isolates as belonging to a single genotype within cluster A1.a, as defined by Lista et al. (Table 1) [17].
Table 1

Results of MLVA genotyping and SNR subgenotyping of B. anthracis isolates from the Pollino National Park 2004 epidemic

MLVA 25

         

Cluster

No. of Isolates

Allele Coding

A1.a

53

VrrA: 10; vrrB1: 16; vrrB2: 7; vrrC1: 57; vrrC2: 21; CG3: 1; bams1: 13; bams 3: 30; bams5: 7; bams13: 30; bams15: 45; bams21: 10; bams22: 16; bams23: 11; bams24: 11; bams25: 13; bams28: 14; bams30: 75; bams31: 64; bams34: 8; bams44: 8; bams51: 9; bams53: 8; pXO1: 7; pXO2: 7.

SNR ANALYSES

  

STR-MTD

KEN-MTD

Subgenotype

No. of Isolates

Loci

Loci

  

CL33

CL12

CL1

CL37

CL33

HM1

CL12

HM2

CL10

HM6

CL35

HM13

SGT-1

46

294

172

243

212

83

91

107

117

SGT-2

4

293

172

243

212

82

91

107

117

SGT-3

1

295

172

243

212

84

91

107

117

SGT-4

1

294

173

243

212

83

92

107

117

SGT-5

1

289

173

243

212

78

92

106

117

TOTAL

53

-

-

-

-

-

-

-

-

Table Top - The 25-loci MLVA cluster group with its allele coding data as defined by Lista et al. [17]. Bottom - SNR alleles are displayed as fragment sizes (base pairs) obtained through capillary electrophoresis. Stratilo's locus nomenclature was used throughout [23]. For results obtained with the KEN-MTD, Kenefic's reference codes are also reported [24]. Alleles differing from those of the most common subgenotype, SGT-1, are underlined and highlighted in bold.

SNR analysis

SNR analysis identified five SGTs. Of 53 isolates, 46 were classified as SGT-1, compared to which four isolates, classified as SGT-2, had a single-base pair deletion corresponding to locus CL33; SGT-3 and SGT-4, each with a single isolate, exhibited insertions in loci CL33 and CL12, respectively, while SGT-5, again with a single isolate, differed from SGT-1 at three loci, with a five-base pair deletion at CL33, an insertion into the CL12 locus, and a deletion at CL10 (Table 1; figure 2).
https://static-content.springer.com/image/art%3A10.1186%2F1746-6148-6-11/MediaObjects/12917_2009_Article_191_Fig2_HTML.jpg
Figure 2

Genetic relationships between epidemic strains sample. The mutational steps from the dominant subgenotype to the minor subgenotypes are shown along the branches, indicating the mutated loci and the number of base pairs deleted (-) or inserted (+).

Discussion

Due to homoplasy, the high mutation rate of SNR loci, estimated at 10-4 per generation in B. anthracis, does not allow a correct definition of phylogenetic relationships between different isolates [15]. SNR is, however, able to detect genetic diversity between closely related strains as would occur in an epidemic [6]. Our method of analysis involved the initial use of 25-loci MLVA to define genetic relationships, and a subsequent investigation of genetic diversity between epidemic strains through SNR analysis.

The 25-loci MLVA assigned all strains to a single genotype within the cluster A1.a, evidence of their autochthonous origin. This particular genotype is frequently found in Basilicata. The two SNR analyses, STR-MTD and KEN-MTD, yielded the same result, identifying five SGTs. The difference between these methods in terms of the amplicon sizes obtained for the common loci is a consequence of the use of different primer pairs. We found the KEN-MTD more useful, as it allows for a multiplexed reaction and permits faster and more reliable detection of fragment sizes, owing to smaller amplicons sizes. Moreover, the KEN-MTD revealed an additional difference between SGT-5 and SGT-1, an allele in the CL10 (Table 1). Polymorphisms were only discovered among the loci with the highest diversity indices (CL33, CL12, CL10) [23].

SGT-1, the most common, was distributed across the epidemic area and present throughout the period under study. SGT-1 was also detected in soil from a grave site, and in the feces of wild boar collected in the same area, suggesting it is the probable ancestral strain. SGTs 2-4 were rarer (6/53) and not present in all phases of the epidemic. These SGTs could represent intra epidemic mutational steps descended from SGT-1. SGT-5, with three loci exhibiting fragment length polymorphism as compared to SGT-1, was the first to be isolated in the affected area, but may have descended from a different, closely related previous outbreak (Table 2).
Table 2

Characterization of the 41 Bacillus anthracis outbreaks of the Pollino National Park 2004 epidemic sample

DATE OF OUTBREAK

STRAIN AND SUBGENOTYPE

FARM CODE

LONGITUDE

LATITUDE

ALTITUDE

ANIMAL DEATHS BY SPECIES

TOTAL

      

BOVINE

OVINE

HORSE

RED DEER

GOAT

 

28/07/2004-

069-SGT-5

025PZ072

40.17564

15.96357

1025

 

1

   

1

25/08/2004

070/072-SGT-1

097PZ111

39.95204

16.13405

1000

1

    

1

30/08/2004- I phase

071-SGT-1

034PZ162

40.06903

16.17553

474

4

 

1

  

5

30/08/2004- I phase

073-SGT-2

097-SGT-1

097PZ065

40.00476

16.13205

800

9

    

9

01/09/2004- I phase

075-SGT-1

097PZ190

39.95204

16.13405

1000

1

 

3

  

4

02/09/2004- I phase

074-SGT-1

078PZ043

40.04136

16.18231

773

1

 

2

  

3

03/09/2004- I phase

078-SGT-1

097PZ009

39.95566

16.11553

800

3

    

3

05/09/2004- I phase

077-SGT-1

023PZ008

40.03877

15.98671

950

7

    

7

06/09/2004- I phase

093-SGT-1

081-SGT-1

028PZ007

40.07953

16.16534

458

 

1

   

1

06/09/2004- I phase

076-SGT-1

070PZ068

39.975

16.02374

330

8

    

8

07/09/2004- I phase

087-SGT-1

078PZ004

40.04

16.181

773

7

    

7

07/09/2004- I phase

083-SGT-1

078PZ012

40.041

16.182

773

7

1

   

8

07/09/2004- I phase

084-SGT-1

unknown

40.003

16.131

800

   

1

 

1

08/09/2004- I phase

092-SGT-1

097PZ107

39.96333

16.07981

620

 

7

   

7

09/09/2004- I phase

No isolates

022PZ014

40.02203

16.00367

720

1

    

1

09/09/2004- I phase

No isolates

022PZ024

40.02101

16.00301

720

1

 

1

  

2

09/09/2004- I phase

No isolates

022PZ041

40.01079

16.02706

700

1

    

1

09/09/2004- I phase

099-SGT-1

022PZ043

40.00578

16.02734

700

3

    

3

09/09/2004- I phase

No isolates

022PZ106

40.03498

15.99999

900

1

    

1

09/09/2004- I phase

091-SGT-2

028PZ171

40.08685

16.23801

450

3

 

1

  

4

10/09/2004- I phase

098-SGT-1

097PZ105

39.97987

16.16671

950

1

    

1

10/09/2004- I phase

096-SGT-1

097PZ152

39.99478

16.04499

630

 

1

   

1

10/09/2004- I phase

089-SGT-1

unknown

40.06463

16.14047

600

   

1

 

1

11/09/2004- I phase

082/095/086-SGT-1

097PZ016

39.95466

16.11453

800

 

3

   

3

12/09/2004- I phase

088/094-SGT-1

030PZ027

40.08343

16.07682

636

1

    

1

13/09/2004- I phase

090-SGT-4

022PZ015

40.01337

15.99796

648

   

1

4

5

14/09/2004- I phase

085-SGT-1

040PZ014

40.07418

15.99999

600

4

1

   

5

15/09/2004- I phase

079-SGT-1

042PZ119

unknown

unknown

1300

1

   

3

4

19/09/2004-II phase

116-SGT-1

040PZ017

40.07418

15.99999

600

1

    

1

19/09/2004- II phase

080-SGT-1

unknown

40.0242

16.30969

619

   

1

 

1

19/09/2004- II phase

117-SGT-1

078PZ096

40.042

16.18589

790

3

    

3

20/09/2004- II phase

113-SGT-1

022PZ010

40.0206

16.0796

723

1

   

1

2

21/09/2004- II phase

106/107-SGT-1

031PZ028

40.11861

16.171

620

1

   

1

2

22/09/2004- II phase

108-SGT-1

042PZ430

40.07374

16.00476

600

4

    

4

22/09/2004- II phase

No isolates

unknown

40.06388

16.00388

942

  

3

  

3

24/09/2004- II phase

112-SGT-3

030PZ003

unknown

unknown

608

1

    

1

27/09/2004-III phase

118-SGT-1

050PZ064

40.18915

15.90076

988

3

    

3

27/09/2004- III phase

100/101-SGT-1

unknown

40.04144

16.08247

910

   

2

 

2

28/09/2004- III phase

102/103-SGT-1

unknown

40.03934

16.0807

924

   

1

 

1

28/09/2004- III phase

114/115-SGT-2

031PZ027

40.11801

16.174

680

1

    

1

29/09/2004- III phase

111-SGT-1

042PZ080

40.05419

15.86776

936

1

    

1

03/10/2004- III phase

119-SGT-1

unknown

unknown

unknown

n.a.

   

1

 

1

22/09/04

104/105-SGT-1

Isolated from soil

unknown

unknown

n.a.

      

21/10/04

120/121-SGT-1

Isolated from feces (wild boar)

unknown

unknown

n.a.

      

TOTAL

     

81

15

11

9

8

124

The 53 B. anthracis strains are numbered (from 069 to 121) following the Anthrax Reference Institute of Italy coding system. For each outbreak, the date and phase of the epidemic is reported, as well as the number of animal deaths and their species. The subgenotype and GIS coordinates of the site of sample collection are indicated for each isolated strain.

Conclusions

The epidemic under study was characterized by a single anthrax clone. Although the epidemic spread over a large area, it involved extremely closely related isolates, 86.7% of which (SGT-1) were identical across the highly discriminating SNR markers. This epidemic was probably exacerbated by the absence of a careful monitoring of animals, making it possible for spores from a recent victim to spread in the environment. The mutational steps found in SGT-2, 3 and 4 may be associated with infective cycles subsequent to the first, while the presence of a more distantly related strain, SGT-5, testifies to the evolutionary history of this lineage in this region. This divergent mutational clone may have originated from different outbreaks in the past. The high throughput genotyping system used in this study proved to be a useful tool for the study of closely related B. anthracis strains, and is therefore potentially valuable not only for the study of epidemics, but also for other contexts requiring the characterization of closely related strains such as the study of biological contaminations through environmental isolates or the forensic investigation of bioterrorist events.

Methods

Bacillus anthracis isolates

In this study, we analyzed 53 B. anthracis strains associated with a single anthrax epidemic.

DNA preparation

Each B. anthracis strain was streaked onto 5% sheep blood agar plates and then incubated at + 37°C for 24 hours. After heat inactivation (98°C for 20 min.), microbial DNA was extracted using DNAeasy Blood and Tissue kit (Qiagen), following the protocol for Gram positive bacteria.

25-loci MLVA and SNR analyses

We utilized 5' fluorescent-labelled oligos, deprotected and desalted, specifically selected for the VNTRs and for the SNRs used.

The 25 specific primer pairs for the MLVA were selected as described by Lista et al. [17]. The eight specific primer pairs for SNR reactions were selected following Stratilo et al. and Kenefic et al. [23, 24] (Table 3).
Table 3

Primers used in this study for MLVA and SNR analyses

 

LOCUS

PRIMER SEQUENCE (5' to 3')

CONCENTRATION μM

MLVA 25

   
 

CG3

F:CY5.5-TGTCGTTTTACTTCTCTCTCCAATAC

R:AGTCATTGTTCTGTATAAAGGGCAT

0.30

 

bams44

F: CY5.5-GCACTTGAATATTTGGCGGTAT

R: GCGAATTAATTGCTCCTCAAAT

0.30

 

bams3

F: CY5.5-GCAGCAACAGAAAACTTCTCTCCAATAACA

R:TCCTCCCTGAGAACTGCTATCACCTTTAAC

0.30

Multiplex A

vrrB2

F: D2-CACAGGCTATTCTTTATCAAACTCATC

R: CCCAAGGTGAAGATTGTTGTTGA

0.15

 

bams5

F: D2-GCAGGAAGAACAAAAGAAACTAGAAGAGCA

R: ATTATTAGCAGGGGCCTCTCCTGCATTACC

0.30

 

bams15

F: D2-GTATTTCCCCCAGATACAGTAATCC

R: GTGTACATGTTGATTCATGCTGTTT

0.60

 

bams1

F: CY5-GTTGAGCATGAGAGGTACCTTGTCCTTTTT

R: AGTTCAAGCGCCAGAAGGTTATGAGTTATC

0.15

 

vrrC1

F: CY5-GAAGCAAGAAAGTGATGTAGTGGAC

R: CATTTCCTCAAGTGCTACAGGTTC

0.30

 

bams13

F: CY5.5-AATTGAGAAATTGCTGTACCAAACT

R: CTAGTGCATTTGACCCTAATCTTGT

0.30

 

vrrB1

F: CY5--ATAGGTGGTTTTCCGCAAGTT

R: GATGAGTTTGATAAAGAATAGCCTGTG

0.10

Multiplex B

bams28

F: CY5-CTCTGTTGTAACAAAATTTCCGTCT

R: TATTAAACCAGGCGTTACTTACAGC

0.15

 

vrrC2

F: CY5-CCAGAAGAAGTGGAACCTGTAGCAC

R: GTCTTTCCATTAATCGCGCTCTATC

0.10

 

bams53

F: D2-GAGGTGTGTTAGGTGGGCTTAC

R: CATATTTTCACCTTAATTTTGGAAG

0.60

 

bams31

F: D2-GCTGTATTTATCGAGCTTCAAAATCT

R: GGAGTACTGTTTGTTGAATGTTGTTT

0.60

 

vrrA

F: CY5.5-CACAACTACCACCGATGGCACA

R: GCGCGTTTCGTTTGATTCATAC

0.06

 

bams25

F: CY5.5-CCGAATACGTAAGAAATAAATCCAC

R: TGAAAGATCTTGAAAAACAAGCATT

0.15

Multiplex C

bams21

F: CY5.5-TGTAGTGCCAGATTTGTCTTCTGTA

R: CAAATTTTGAGATGGGAGTTTTACT

0.30

 

bams34

F: D2-TGTGCTAAATCATCTTGCTTGG

R: CAGCAAAATCAATCGAATCAAA

0.30

 

bams24

F: CY5-CTTCTACTTCCGTACTTGAAATTGG

R: CGTCACGTACCATTTAATGTTGTTA

0.30

 

bams51

F: CY5-ATTTCCTGAAGCAGGTTGTGTT

R: TGCATCTAACAATGCAGAACAA

0.60

 

bams22

F: CY5-ATCAAAAATTCTTGGCAGACTGA

R: ACCGTTAATTCACGTTTAGCAGA

0.15

Multiplex D

bams23

F: D2-CGGTCTGTCTCTATTATTCAGTGGT

R: CCTGTTGCTCCTAGTGATTTCTTAC

0.30

 

bams30

F: CY5.5-AGCTAATCACCTACAACACCTGGTA

R: CAGAAAATATTGGACCTACCTTCC

0.30

 

pXO1

F: CY5-CAATTTATTAACGATCAGATTAAGTTCA

R: TCTAGAATTAGTTGCTTCATAATGGC

0.15

 

pXO2

F: CY5.5-TCATCCTCTTTTAAGTCTTGGGT

R: GTGTGATGAACTCCGACGACA

0.15

STR-MTD

   

Singleplex A

CL33

F: 6FAM-TGGGGTATATTCCCATCGAA

R:CCGCAGATACCAACCAACAT

0.2

Singleplex B

CL12

F: 6FAM-AAGCCAGGTGCAAAAACAGT

R: TCTCACTGTGCCTCGCTAAA

0.2

Singleplex C

CL1

F: 6FAM-TTCTCGGAGATGATTTTCGG

R:CTCCCATTTTACATCCCCCT

0.2

Singleplex D

CL37

F: NED-CTCCGCAATTTTCAAACGAT

R: CCGCCGGCATAAAGATAGTA

0.2

KEN-MTD

   
 

CL33

HM1

F: PET GAAAACTTTGCAACCGACC

R: GTCGAACGTGTTCTAGCTACAG

0.2

Multiplex I

CL10

HM6

F: 6FAM-TAAAAAGACAGAATTTTCAATTTTATCAACAAC

R: GTGGAAACTAATGTGAGTTATATATGTTAGTTAAG

0.2

 

CL12

HM2

F: VIC-GCTATTCTCACTGTGCCTCG

R: GTTAAAACGAAGTAAAGAAAAGTGGG

0.2

 

CL35

HM13

F: NED-GGATTGCTTAAGGTATATAATGGATTT

R: GTTGTGTTCCATATGTATCCCTCC

0.1

MLVA PCRs were performed in four multiplex reactions in a final volume of 15 μl. The reaction mixture contained: 1× PCR reaction buffer (Roche), 1 U of Taq DNA polymerase (Roche), dNTPs (0.2 mM each), and appropriate concentrations of each primer as reported in Table 3. The thermocycling conditions were as follows: 96°C for 3 min; 36 cycles at 95°C for 20 s, at 60°C for 30 s, and at 72°C for 1 min; and finally, 72°C for 10 min.

The KEN-MTD PCR was performed in a multiplex reaction in a final volume of 25 μl containing 1× AmpliTaq Gold PCR buffer and 0.5 U of AmpliTaq Gold DNA polymerase (Applied Biosystems Inc.), 3,5 mM MgCl2, dNTPs (0.2 mM each), and appropriate concentrations of forward and reverse primers as reported in Table 3.

STR-MTD PCRs were performed in four singleplex reactions in a final volume of 25 μl containing 1× AmpliTaq Gold PCR buffer and 0.5 U of AmpliTaq Gold DNA polymerase (Applied Biosystems Inc.), 4 mM MgCl2, dNTPs (0.2 mM each), and appropriate concentrations of forward and reverse primers as reported in Table 3. The thermocycling conditions were as follows: 95°C for 5 min; 35 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s; and finally, 72°C for 7 min.

Automated genotype analysis

MLVA PCR products were diluted 1:5. Five μl of solution were added to a mix containing 40 μl of Sample Loading Solution (Beckman Coulter) and 0.5 μl of MapMarker 1000 size marker (BioVentures Inc.). Amplicons were separated by electrophoresis on a CEQ 8000 automated DNA Analysis System (Beckman Coulter) and sized by CEQ Fragment Analysis System software.

Amplified SNR PCR products were diluted 1:80 and subjected to capillary electrophoresis on ABI Prism 3130 genetic analyzer (Applied Biosystems) with 0.25 μl of GeneScan 120 Liz and 500 Liz size standards for KEN-MTD and STR-MTD amplicons, respectively, and sized by GeneMapper 4.0 (Applied Biosystems Inc.). DNA extracted from each sample was tested by two different laboratories: the Anthrax Reference Institute of Italy, and the Army Medical and Veterinary Research Institute.

Declarations

Acknowledgements

This work was financed by the Italian Ministry of Health (DIAGNOVA funds, Ricerca Corrente 2006). We thank Angela Aceti, Giuseppe Stramaglia, Nicola Nigro and Rosa d'Errico for their excellent technical support.

Authors’ Affiliations

(1)
Istituto Zooprofilattico Sperimentale della Puglia e della Basilicata, Anthrax Reference Institute of Italy- Foggia
(2)
Army Medical and Veterinary Research Institute
(3)
Istituto Superiore di Sanità

References

  1. Fasanella A, Van Ert M, Altamura SA, Garofolo G, Buonavoglia C, Leori G, Huynh L, Zanecki S, Keim P: Molecular diversity of Bacillus anthracis in Italy. J Clin Microbiol. 2005, 43: 3398-3401. 10.1128/JCM.43.7.3398-3401.2005.PubMed CentralPubMedView ArticleGoogle Scholar
  2. Hugh-Jones ME, de Vos V: Anthrax and wildlife. Rev Sci Tech. 2002, 2: 359-389.Google Scholar
  3. Hugh-Jones ME: 1996-97 Global Anthrax report. J Appl Microbiol. 1999, 87: 189-191. 10.1046/j.1365-2672.1999.00867.x.PubMedView ArticleGoogle Scholar
  4. Turner AJ, Galvin JW, Rubira RJ, Condron RJ, Brandley T: Experiences with vaccination and epidemiological investigations on an anthrax outbreak in Australia in 1997. J of Appl Microbiol. 1999, 87: 294-298. 10.1046/j.1365-2672.1999.00894.x.View ArticleGoogle Scholar
  5. Turnbull PC, Bell RH, Saigawa K, Munyenyembe FE, Mulenga CK: Anthrax in wildlife in Luangwa Valley, Zambia. Vet Rec. 1991, 128: 399-403.PubMedView ArticleGoogle Scholar
  6. Fasanella A, Palazzo L, Petrella A, Quaranta V, Romanelli B, Garofolo G: Anthrax in red deer (Cervus elaphus), Italy. Emerg Infect Dis. 2007, 13 (7): 1118-9.PubMed CentralPubMedView ArticleGoogle Scholar
  7. Dragon DC, Rennie RP: ecology of anthrax spores: tough but not invincible. Can Vet J. 1999, 36 (5): The295-301.Google Scholar
  8. Dragon DC, Bader DE, Mitchell J, Woollen N: Natural dissemination of Bacillus anthracis spores in Northern Canada. Appl Environ Microbiol. 2005, 71 (3): 1610-1615. 10.1128/AEM.71.3.1610-1615.2005.PubMed CentralPubMedView ArticleGoogle Scholar
  9. Mitzmain MB: Experimental insect transmission of anthrax. Public Health Reports. 1914, 29: 75-7716.View ArticleGoogle Scholar
  10. Kraneveld FC, Djaenoedin R: Test on the dissemination of anthrax by Tabanus rubidus in horses and buffalo. Overgedrukt uit de Nederlands-Indische Bladen Voor Diergeneeskunde. 1940, 52: 339-80.Google Scholar
  11. Rao NS, Mohiyudeen S: Tabanus flies as transmitters of anthrax - a field experience. Indian Veterinary Journal. 1958, 35: 348-353.Google Scholar
  12. Davies JC: A major epidemic of anthrax in Zimbabwe. Part II. Cent Afr J Med. 1983, 29 (1): 8-12.PubMedGoogle Scholar
  13. Turrel MJ, Knudson GB: Mechanical transmission of Bacillus anthracis by stable flies (Stomoxys calcitrans) and mosquitoes (Aedes aegypti and Aedes taeniorhynchus). Infection and immunity. 1987, 55: 1859-1961.Google Scholar
  14. Hugh-Jones M, Blackburn J: The ecology of Bacillus anthracis. Molecular Aspects of Medicine. 2009, 30 (6): 356-67. 10.1016/j.mam.2009.08.003.PubMedView ArticleGoogle Scholar
  15. Keim P, van Ert MN, Pearson T, Vogler AJ, Huynh LY, Wagner DM: Anthrax molecular epidemiology and forensics: using the appropriate marker for different evolutionary scales. Infect Genet Evol. 2004, 4: 205-213. 10.1016/j.meegid.2004.02.005.PubMedView ArticleGoogle Scholar
  16. Keim P, Price LB, Klevytska AM, Smith KL, Schupp JM, Okinaka R, Jackson P, Hugh Jones ME: Multiple-Locus Variable-Number Tandem Repeat Analysis Reveals Genetic Relationships within Bacillus anthracis. J Bacteriology. 2000, 182: 2928-2936. 10.1128/JB.182.10.2928-2936.2000.View ArticleGoogle Scholar
  17. Lista F, Faggioni G, Valjevac S, Ciammaruconi A, Vaissaire J, le Doujet C, Gorge O, de Santis R, Carattoli A, Ciervo A, Fasanella A, Orsini F, D'Amelio R, Pourcel C, Cassone A, Vergnaud G: Genotyping of Bacillus anthracis strains based on automated capillary. BMC Microbiology. 2006, 6: 6-33. 10.1186/1471-2180-6-33.View ArticleGoogle Scholar
  18. Fouet A, Smith KL, Keys C, Vaissaire J, Le Doujet C, Lévy M, Mock M, Keim P: Diversity Among French Bacillus anthracis Isolates. J Clin Microbiol. 2002, 40: 4732-4734. 10.1128/JCM.40.12.4732-4734.2002.PubMed CentralPubMedView ArticleGoogle Scholar
  19. Gierczynski R, Jakubczak A, Jagielski M: Extended multiple-locus variable tandem-repeat analysis of Bacillus anthracis isolated in Poland. Pol J Microbiol. 2009, 58 (1): 3-7.PubMedGoogle Scholar
  20. Van Ert M, Easterday WR, Huynh LY, Okinaka RT, Hugh-Jones ME, Ravel J, Zanecki SR, Pearson T, Simonson TS, U'Ren JM, Kachur SM, Leadem-Dougherty RR, Rhoton SD, Zinser G, Farlow J, Coker PR, Smith KL, Wang B, Kenefic LJ, Fraser-Liggett CM, Wagner DM, Keim P: Global Genetic Population Structure of Bacillus anthracis. PlosOne. 2007, 5: 461-471.View ArticleGoogle Scholar
  21. Pearson T, Busch JD, Ravel J, Read TD, Rhoton SD, U'Ren JM, Simonson TS, Kachur SM, Leadem RR, Cardon ML, Van Ert MN, Huynh LY, Fraser CM, Keim P: Phylogenetic discovery bias in Bacillus anthracis using single-nucleotide polymorphisms from whole-genome sequencing. Procl Nat Acad Sci USA. 2004, 101 (37): 13536-41. 10.1073/pnas.0403844101.View ArticleGoogle Scholar
  22. Read TD, Salzberg SL, Pop M, Shumway M, Umayam L, Jiang L, Holtzapple E, Busch JD, Smith KL, Schupp JM, Solomon D, Keim P, Fraser CM: Comparative genome sequencing for discovery of novel polymorphisms in. Bacillus anthracis. 2002, 296 (5575): 2028-33.Google Scholar
  23. Stratilo CW, Lewis CT, Bryden L, Mulvey MR, Bader D: Single-nucleotide repeat analysis for subtyping Bacillus anthracis. J Clin Microbiol. 2006, 44 (3): 777-8. 10.1128/JCM.44.3.777-782.2006.PubMed CentralPubMedView ArticleGoogle Scholar
  24. Kenefic LJ, Beaudry J, Trim C, Huynh L, Zanecki S, Matthews M, Schupp J, Van Ert M, Keim P: A high resolution four-locus multiplex single nucleotide repeat (SNR) genotyping system in Bacillus anthracis. J Microbiol Methods. 2008, 73 (3): 269-72. 10.1016/j.mimet.2007.11.014.PubMedView ArticleGoogle Scholar

Copyright

© Garofolo et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement